...control of neuronal activity. Table 1. Descriptions of DREADDs and their activity in neurons DREADD Receptor...activates neuronal activity. Figure 2. PSAM4-based LGICs, their effect, and outcome in neurons. Please ...their activity in neurons PSAM Ion Pore Domain Ligand(s) Effect Outcome (in neurons) Reference PSAM4 Gly...influx Neuronal activation Magnus et al, 2019 PSAM Q79G,Q139G Gly PSEM 22S Cl- influx Neuronal inhibition...influx Neuronal activation Magnus et al, 2011 PSAM L141F,Y115F Gly PSEM 89S Cl- influx Neuronal inhibition...be expressed. However, neuronal control through PSAMs is direct, while neuronal control of DREADDs is ...Specificity hSyn1, CaMKIIa Neurons GFAP Glia CD68 Microglia Dlx Interneurons EF1a, CAG General expression...

...specific subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and ...expressed in all GABAergic neurons. In this case, the subpopulation of GABAergic neurons being activated by the...engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular processes. The...channelrhodopsin, fused to mCherry, is expressed in neurons (red dots). When exposed to light of the correct...cations flow into the cell (yellow dots), and the neuron is activated. Optogenetics tools can be broadly...and nervous system to better map and understand neuronal circuits. Optogenetic tools have also been used...Drosophila. These tools have been instrumental in neurological disorder research, helping scientists to better...

... as pBAD-R, reverse primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer...

...engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular processes. The...

... as alter tropism. For example, AAV2/5 targets neurons that are not efficiently transduced by AAV2/2, ...

... genomes have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...

...expanded targeting space. 2018. Nishimasu H, Shi X, Ishiguro S, Gao L, Hirano S, Okazaki S, Noda T, Abudayyeh...