Skip to main content
Addgene
Showing: 281 - 300 of 395 results

  1. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ...Gene/Insert Promoter Selectable Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable ...modifiers. Design your gRNA to target a specific promoter or enhancer for your gene of interest. Available...

  2. Academic vs. Industry Postdocs

    Type
    Blog Post
    ...a requirement. Your manager: Unlike academia, promotions in industry are based on people’s ability to ...

  6. PhD Applications After COVID

    Type
    Blog Post
    ...feasible. Through the virtual systems created and promoted during COVID-19, online meetings with current ...

  7. Synthetic Biology - Overview

    Type
    Collection
    ... and synthetic regulatory elements, including promoters, terminators, repressors, activators, and more...Featured SynBio Deposits Alper Lab Y. Lipolytica Promoters Anderson Lab Plasmids and Phagemids Balazsi Lab...Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter/BCD Kit , and pOSIP Plasmid Kit Gray Lab Maize...community-created BioBricks BioBricks Foundation - Promoting open and ethical synthetic biology JBEI - Joint...

  8. Cre-lox system

    Type
    Collection
    ...system is tight temporal regulation. Promoter-regulated Cre: The promoter region defines the areas in which...active promoter like CAG, or expressed only in a subset of cells under a more specific promoter (e.g. ... PBAD promoter Bacterial Richmond 112614 pVHC Venus and Cre-ERT2 with MCS for inserting promoter none ...inserting promoter none Mammalian Heller 112616 pmTHC TFP and Cre-ERT2 with MCS for inserting promoter none...respectively) and placed under the control of different promoters. Expression of both N and CCre in the same cell...your experiment. You can search the table for the promoter, fusion, or expression system of choice. We also...currently in our repository. ID Plasmid Description Promoter Expression System PI 8394 p209 pCMV-cre-K Cre-...

  9. CRISPR Plasmids - Purify Genomic Loci

    Type
    Collection
    ...Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable...Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions...

  10. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...Plasmid Gene/Insert Promoter PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Plant...Plant ID Plasmid Gene/Insert Promoter PI Publication Last reviewed on: January 30, 2025 Do you have suggestions...

  11. Caltech Systemic Capsids

    Type
    Collection
    ... window) . Browse Available PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato... #103006) . Browse Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato...#127847) . Browse Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP...#185136) . Browse Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#185137) . Browse Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175004) . Browse Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175005) . Browse Available CAP-B22 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...

  12. Validated gRNA Sequences

    Type
    Collection
    ...CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S.... or repression experiments use targets within promoters. When possible, the categories described on Addgene's... 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes...pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949...23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m...GTTGAAAGTATTAGTTAAAG 64388 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate...

  13. Lab to Office Culture Shock

    Type
    Blog Post
    ...be these skills that get you your next job or promotion. Also, don’t wait until you’re out of the lab ...
Showing: 281 - 300 of 395 results