-
Plasmid#1186DepositorInserthtt 103Q (HTT Human)
UseTagsGFPExpressionYeastMutationPromoterAvailable sinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T646A
Plasmid#74937PurposeMammalian expression of human NSF mutant T646A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
UseTagsFLAGExpressionMammalianMutationT646A (mutation in the D2 domain of the protein)PromoterCMVAvailable sinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T645A
Plasmid#74936PurposeMammalian expression of human NSF mutant T645A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
UseTagsFLAGExpressionMammalianMutationT645A (mutation in the D2 domain of the protein)PromoterCMVAvailable sinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
3'-ecRESCUE-mCherry
Plasmid#191486PurposeecDHFR DD-mCherry, an inducible ecRESCUE RNA base editor: TMP-induced ecDHFR DD expression allows reversible control of the expression of dRanCas13b-ADAR2-mCherryDepositorUseCRISPRTagsExpressionMammalianMutationPromoterCMVAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 hMOG-alpha1-EGFP
Plasmid#126463PurposeExpression a human MOG (isoform alpha1) EGFP fusion protein in mammalian cellsDepositorInsertMyelin oligodendrocyte glycoprotein (MOG Human)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHEE401E
Plasmid#71287PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-SEC61B.N-BSD.P2A.miniIAA7.3xFlag
Plasmid#216250PurposeHDR template to tag endogenous human SEC61B N-terminus with BSD.P2A.miniIAA7.3xFlagDepositorInsertHDR template for human SEC61B (SEC61B Human, Synthetic, HDR template)
UseCRISPR; Hdr templateTagsBSD.P2A.miniIAA7.3xFlagExpressionMammalianMutationPromoterAvailable sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(MS2)_EF1a-MS2-P65-HSF1
Plasmid#92120PurposeExpression plasmid for both MS2-P65-HSF1 activator helper complex and sgRNA with two MS2 loops at tetraloop and stemloop 2 contains BsaI sites for insertion of spacer sequences.DepositorInsertMS2-P65-HSF1 (HSF1 Human, Synthetic)
UseCRISPRTagsExpressionMammalianMutationPromoterEF1aAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHEE401
Plasmid#71286PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertssgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 promoter and U6-26p Arabidopsis U6 gene pro…Available sinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
Plasmid#115694PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.DepositorInsertsNmeCas9
Nme-sgRNA
UseCRISPRTagsNLS and NLS, HAExpressionInsect and MammalianMutationNone and fusion of repeat/tracrRNA to make a sgRNAPromoterEF-1 alpha and U6Available sinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX_TRC311/NLS-Cas13d-P2A-Blast
Plasmid#212196PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-Blasticidin for RNA targeting. CasRx-2A-Blasticidin is driven by EF1a promoter. EGFP is driven by SV40DepositorInsertCasRx (NLS-RfxCas13d-NLS)-HA with 2A-Blasticidin
UseCRISPR and LentiviralTagsHA, NLS, and blasticidin S deaminaseExpressionMammalianMutationPromoterEF-1α promoterAvailable sinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSC-LHX8-IRES-GBX1
Plasmid#182235PurposeTo convert human skin fibroblasts into induced basal forebrain cholinergic neurons (hiBFCNs) in combination with ASCL1, Sox11, FGF2 and two small molecules, forskolin and LDN-193189DepositorUseLentiviralTagsExpressionMutationPromoterCMVAvailable sinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdCas9 (GB1079)
Plasmid#75399PurposeProvides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid part for C-terminal fusionsDepositorInsertCas9 coding region with mutated (D10A, H840A) and inactivated catalytic domains (human codon optimised)
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMSCV_FLT3
Plasmid#223566PurposeThe plasmid is expressed FLT3 in mammalian cells.DepositorInsertFLT3 wild type (FLT3 Human)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1664 - pAAV SYN1 mGas6(delta)-Myc-DDK
Plasmid#202541PurposeAn adeno-associated viral vector expressing murine Gas6 with deletion of (F50-E275) fused Myc and DDK epitopes from a synapsin promoterDepositorInsertGas6 (Gas6 Mouse)
UseAAVTagsMyc-DDKExpressionMutationDeletion of F50-E275PromoterSYN1Available sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
-
EF1a-L274GMmMetRS-T2A-mCherry
Plasmid#220800PurposeLentivirus expressing mutant tRNA synthetase for incorporation of noncanonical amino acids in nascent proteins plus mCherry reporter and puro resistanceDepositorInsertMars1 (Mars1 Mouse)
UseLentiviralTags2xFLAG and T2A-mCherryExpressionMutationmutation in MetRS to change aa 274 from L to GPromoterEF1aAvailable sinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX311-GFP-MEKDD
Plasmid#194882PurposeExpression of dominant negative MEK1DepositorInsertMEKDD (MAP2K1 Human)
UseLentiviralTagsExpressionMammalianMutationS218D, S222DPromoterE1FaAvailable sinceMarch 31, 2023AvailabilityAcademic Institutions and Nonprofits only