-
Plasmid#113691PurposeU6 driven SaCas9 gRNA expression cassette followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorInsertSaCas9
UseAAV, CRISPR, and Cre/LoxTagsNLSExpressionMutationPromoterCytomegalo Virus(CMV)Available sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA
Plasmid#113692PurposeU6 SaCas9 gRNA expression cassette containing a gRNA targeting the CREB gene, followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsNLSExpressionMutationPromoterCytomegalo Virus(CMV)Available sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-pX330-Cas9-Blast
Plasmid#159741PurposeExpresses Cas9-2A-Blast and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.DepositorInsertdonor plasmid targeting sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-pX330-Cas9-mCherry
Plasmid#159742PurposeExpresses Cas9-2A-mCherry and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.DepositorInsertdonor plasmid targeting sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-EFS-HypaSpCas9-P2A-EGFP
Plasmid#106964Purposesingle-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screenDepositorInsertHypaSpCas9
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFSAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-EFS-HypaSpCas9-P2A-puro
Plasmid#106965Purposesingle-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screenDepositorInsertHypaSpCas9
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFSAvailable sinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-dCas9-VPR-H2B-mCherry (CRISPRa)
Plasmid#175572PurposeInactivated Cas9 (dCas9) fusion to VPR for the purpose of targeted activationDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable sinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-dCas9-VPR-H2B-GFP (CRISPRa)
Plasmid#175571PurposeInactivated Cas9 (dCas9) fusion to VPR for the purpose of targeted activationDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable sinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_T2A_mCherry sg1-sg2
Plasmid#192479PurposeAll-in-one plasmid containing both guides for cutting BFP region in DSB Spectrum V1DepositorInsertSpCas9
UseTagsT2A mCherryExpressionMammalianMutationPromoterAvailable sinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cas9 sgRNA vector
Plasmid#68463PurposeCas9 sgRNA vector for cloningDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462)
Plasmid#48141PurposeNOTE: A new version of this plasmid is now available. See Addgene plasmid 62987DepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable sinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-idCas9-vpr
Plasmid#89985Purposeinducible CRISPR-ON system for controllable gene activation; this plasmid is used to insert dCas9-VPR casette in one allele of AAVS1 locusDepositorInsertdCas9-VPR
UseTagsExpressionMammalianMutationPromoterTRE-tightAvailable sinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
Native promoter dCas9
Plasmid#113656PurposedCas9 expression unit plasmid. The dCas9 expression unit plasmids contain connector ConL1, ConRE, and one dCas9 transcriptional unit.DepositorInsertNative promoter and dCas9
UseCRISPRTagsExpressionBacterialMutationPromoterS. pyogenes Cas9 native promoterAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-dCas9-ZIM3-KRAB-BFP
Plasmid#196712PurposeCRISPR-inhibition. dCas9-KRAB(ZIM3) with TagBFP for sorting. Improved KRAB domain from ZIM3DepositorInsertdCas9-KRAB(ZIM3)-T2A-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSExpressionMutationD10A, N863APromoterEF1aAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Blast
Plasmid#118055PurposeUsed for expression of sgRNA in mammalian cellsDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNA
Plasmid#110624PurposeA single vector AAV-Cas9 system containing a liver-specific promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseAAV, CRISPR, and Mouse TargetingTagsSV40 NLSExpressionMammalianMutationPromoterLP1B and hU6Available sinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3A2
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4A6
Plasmid#73434PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4A6.DepositorInsertRepressor 4A6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4F2
Plasmid#73431PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4F2.DepositorInsertRepressor 4F2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1B6
Plasmid#73430PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.DepositorInsertRepressor 1B6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3H5
Plasmid#73429PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3H5.DepositorInsertRepressor 3H5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1D4
Plasmid#73433PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1D4.DepositorInsertRepressor 1D4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1E4
Plasmid#73436PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1E4.DepositorInsertRepressor 1E4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-5F5
Plasmid#73432PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 5F5.DepositorInsertRepressor 5F5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-Exo-Blast-BFP
Plasmid#196721PurposeSortable and selectable SpCas9 fused to exodeoxyribonuclease I (sbcB) from E. coli. For the creation of longer deletions.DepositorInsertCas9-Exo1-T2A-BSD-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSExpressionMutationPromoterEF1aAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Puro_hs_NC_chr1
Plasmid#214688PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralTagsExpressionMutationPuromycin resistance cassette has silent mutation…PromoterAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Puro_hs_TP73
Plasmid#214689PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralTagsExpressionMutationPuromycin resistance cassette has silent mutation…PromoterAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-dCas9-VPR-wpA-pPuroTK
Plasmid#214127PurposeGene expression by Piggybac transposase in mammalian cellsDepositorInsertdCas9-VPR
UseCRISPRTagsExpressionMammalianMutationCodon-optimized for mammalian cellsPromoterAvailable sinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP774_dCas9-Spy-Snoop-Sunx5-Avi-Tag-BFP (dCas9-SSSavi-BFP)
Plasmid#211767PurposedCas9 docking array with four tag domains (Spy, Snoop, aGCN4, Avi), with BFP selectionDepositorInsertdCas9, Spy, Snoop, aGCN4, AviTags
UseTags3xHAExpressionMammalianMutationdCas9 D10A and H840APromoterpGK and pEF1aAvailable sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-VP64-dCas9-VP64-ZsG
Plasmid#192667Purpose3rd generation lenti vector encoding VP64-dCas9-VP64 with 2A ZsGreen1DepositorInsertVP64-dCas9-VP64, ZsGreen1
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1aAvailable sinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-dCas9_puroR
Plasmid#219825PurposeCMV-driven expression of dCas9 with puromycin resistance (Adapted from plasmid #68416)DepositorInsertdCas9
UseCRISPRTagsExpressionMammalianMutationD10A/H841APromoterCMVAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMEG_YLCas9_empty
Plasmid#117826PurposeCRISPR/Cas9 plasmid for GoldenMOCS in Y. lipolyticaDepositorInsertYlpTEF_hCas9_YlCyc1TT
UseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBP_dCas9
Plasmid#190131PurposeLevel 0 MoClo plasmid containing dCas9DepositorInsertdCas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Thy-1-CRISPR-gRNA#1-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124283PurposesgRNA against human Thy-1DepositorInsertHomo sapiens Thy-1 cell surface antigen (THY1), transcript variant 1 (THY1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Thy-1-CRISPR-gRNA#3-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124285PurposesgRNA against human Thy-1DepositorInsertHomo sapiens Thy-1 cell surface antigen (THY1), transcript variant 1 (THY1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Thy-1-CRISPR-gRNA#2-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124284PurposesgRNA against human Thy-1DepositorInsertHomo sapiens Thy-1 cell surface antigen (THY1), transcript variant 1 (THY1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-dCas9-VP64-MS2-VP64-ZsG
Plasmid#192669PurposeDox-inducible expression of dCas9-VP64 with P2A MS2-VP64 and T2A ZsGreen1DepositorInsertdCas9-VP64, MS2-VP64, ZsGreen1
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A and N863A in Cas9PromoterTRE3GAvailable sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA15.0 Cas9
Plasmid#138944PurposeFungal AMA1 plasmid with sp-Cas9, ribozymes based "plug-and-play" sgRNA transcription unit, Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_Cas9_2xNLS; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSExpressionMutationPromoterp40S (AN0465) Aspergillus nidulansAvailable sinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
dCas9-miniTurbo
Plasmid#219822PurposeEF1α-driven expression of dCas9 fused to miniTurbo with GFP (Adapted from plasmid #153209)DepositorInsertdCas9
UseCRISPRTagsminiTurboExpressionMammalianMutationD10A/H841APromoterEF1aAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
UseTagsExpressionMutationPromoterQuorum sensing promoterAvailable sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMCS-rybozyme-IRES-CAS9
Plasmid#64668PurposePlasmid encoding multiple cloning site, rybozyme and IRES-CAS9.DepositorInsertsCAS9
HDV ribozyme
UseCRISPRTagsFlag, Internal ribosome entry site, and guide RNA…ExpressionMammalianMutationPromoterAvailable sinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiV2-dCas9-VP64
Plasmid#141104PurposeExpression of gRNA and dCas9-VP64 from the same plasmid for CRISPRaDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCW-Tet-Cas9-BFP-PGK-Blast
Plasmid#196720PurposeTet-inducible expression of Cas9-T2A-TagBFPDepositorInsertCas9-T2A-TagBFP
UseCRISPR and LentiviralTags3xFLAG-SV40NLS and Nucleoplasmin NLSExpressionMutationPromoterTRE, PGKAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW-Tet-Cas9-miRFP670nano-PGK-Blast
Plasmid#196722PurposeTet-inducible expression of Cas9-T2A-miRFP670nanoDepositorInsertCas9-T2A-miRFP670nano
UseCRISPR and LentiviralTags3xFLAG-SV40NLS and Nucleoplasmin NLSExpressionMutationPromoterTRE, PGKAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only