Skip to main content
Addgene

Intron-Tagging-pX330-Cas9-mCherry
(Plasmid #159742)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159742 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pU6-(BbsI)_CBh-Cas9-T2A-mCherry (Plasmid #64324)
  • Backbone manufacturer
    Ralf Kuehn lab
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    donor plasmid targeting sgRNA
  • gRNA/shRNA sequence
    gagatcgagtgccgcatcac
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Intron-Tagging-pX330-Cas9-mCherry was a gift from Stefan Kubicek (Addgene plasmid # 159742 ; http://n2t.net/addgene:159742 ; RRID:Addgene_159742)
  • For your References section:

    Pooled protein tagging, cellular imaging, and in situ sequencing for monitoring drug action in real time. Reicher A, Koren A, Kubicek S. Genome Res. 2020 Dec;30(12):1846-1855. doi: 10.1101/gr.261503.120. Epub 2020 Nov 17. 10.1101/gr.261503.120 PubMed 33203764