-
Plasmid#208392PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ATM gene.DepositorInsertsgATM (Atm Mouse)
UseLentiviral and LuciferaseTagsExpressionMammalianMutationWTPromoterAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNluc-sgControl
Plasmid#208383PurposeThis sgControl, located in the TP53BP1 intron, serves as a control sgRNA for the others. The vector was cloned from Lenti-sgRNA-Cre-GpNLuc.DepositorInsertsgControl (TP53BP1 intron) (Trp53bp1 Mouse)
UseLentiviral and LuciferaseTagsExpressionMammalianMutationWTPromoterAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmMRE11
Plasmid#208384PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MRE11 gene.DepositorInsertsgMRE11 (Mre11a Mouse)
UseLentiviral and LuciferaseTagsExpressionMammalianMutationWTPromoterAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#3
Plasmid#208389PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#3 gene.DepositorInsertsgZBP1 (Zbp1 Mouse)
UseLentiviral and LuciferaseTagsExpressionMammalianMutationWTPromoterAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmMLKL
Plasmid#208391PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MLKL gene.DepositorInsertsgMLKL (Mlkl Mouse)
UseLentiviral and LuciferaseTagsExpressionMammalianMutationWTPromoterAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 hU6 ACTB sgRNA
Plasmid#206270PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes hU6 hACTB sgRNADepositorInsertACTB sgRNA
UseCRISPR; Multimate/gateway entr 2TagsExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-BFP
Plasmid#202823PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete exon 1 within ZNF91 gene
UseLentiviralTagsExpressionMammalianMutationPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRTagsExpressionMutationPromotermouse U6Available sinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP
Plasmid#194016PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.2)
eGFP
UseAAV and CRISPRTagsExpressionMammalianMutationPromotercmb and u6Available sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSK-mU6-Cj-sgRNA-SV40-puro
Plasmid#192128PurposeExpresses Cj-SgRNA scaffold cloned with BbsI and puromycin resistance geneDepositorInsertCj-SgRNA scaffold
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-tdTomato-sgRNA
Plasmid#194724Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA that target tdTomatoDepositorArticleInsertAsCpf1
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-3 lentiCRISPR v2-Blast plasmid
Plasmid#192233Purposelentiviral vector expressing sgRNA-3 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-3 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-5 lentiCRISPR v2-Blast plasmid
Plasmid#192230Purposelentiviral vector expressing sgRNA-5 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-5 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192234Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192229Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Flag-Mcm2 targeting sgRNA
Plasmid#186937PurposeGenomic targeting of Flag tag at Mcm2 N-terminalDepositorInsertFlag-Mcm2 targeting sgRNA (Mcm2 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro(PX459)-GJA1 sgRNA
Plasmid#164471PurposeExpresses sgRNA targeting human GJA1 locusDepositorInsertGap junction alpha-1 (GJA1) (GJA1 Human)
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX(Cas12k-TniQ)-sgRNA_entry (CJT111)
Plasmid#181790PurposeExpresses 3-component ShHELIX containing a Cas12k-TniQ fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTnsC, ShCas12k-ShTniQ
UseTagsExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
330-BFP-hCYP3A4-enhancer-R-sgRNA
Plasmid#176841PurposeTargeting human CYP3A4 proximal enhancer right boundary. sgRNA expressing cells could be FACS sorted by BFP expression.DepositorInsertHuman CYP3A4 proximal enhancer right boundary
UseTagsExpressionMammalianMutationPromoterU6Available sinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only