px459-Flag-Mcm2 targeting sgRNA
(Plasmid
#186937)
-
PurposeGenomic targeting of Flag tag at Mcm2 N-terminal
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186937 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepx459
- Backbone size w/o insert (bp) 9174
- Total vector size (bp) 9194
-
Vector typeMammalian Expression, Mouse Targeting, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFlag-Mcm2 targeting sgRNA
-
gRNA/shRNA sequenceCGGTGGAGCTAGCGCAGACA
-
SpeciesM. musculus (mouse)
-
Entrez GeneMcm2 (a.k.a. AA959861, AW476101, BM28, CDCL1, Mcmd2, mKIAA0030)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px459-Flag-Mcm2 targeting sgRNA was a gift from Zhiguo Zhang (Addgene plasmid # 186937 ; http://n2t.net/addgene:186937 ; RRID:Addgene_186937) -
For your References section:
Stable inheritance of H3.3-containing nucleosomes during mitotic cell divisions. Xu X, Duan S, Hua X, Li Z, He R, Zhaang Z. Nat Commun. 2022 May 6;13(1):2514. doi: 10.1038/s41467-022-30298-4. 10.1038/s41467-022-30298-4 PubMed 35523900