Showing: 9641 - 9660 of 18097 results
-
Plasmid#71325PurposetetA landing pad template plasmidDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only
-
Murine E-cadherin mCherry
Plasmid#71366Purposemammalian expression of murine E-caderin with mCherry fusionDepositorInsertE-cadherin (Cdh1 Mouse)
UseTagsmCherryExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
Human Beta-catenin GFP
Plasmid#71367Purposemammalian expression of human Beta-catenin GFPDepositorInsertBeta-catenin (CTNNB1 Human)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
GFP-AHPH-DM
Plasmid#71368PurposeLocation sensor for RhoA-GTPDepositorInsertC terminus of Anillin (ANLN Human)
UseTagsEGFPExpressionMammalianMutationA740D and E758KPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
Grp1-PH pEGFP-C1
Plasmid#71378PurposeFor analysis of PH domain localization in mammalian cellsDepositorInsertGrp1-PH (Cyth3 Mouse)
UseTagsEGFPExpressionMammalianMutationPleckstrin homology (PH) domain; aa 247-399PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pAAV-hysn-flex-dsRed-shscramble
Plasmid#71383PurposeExpresses scramble shRNA Cre-dependently by flex switchDepositorInserthuman synapsin promoter-flex switch-dsRed-shscramble
UseAAV, Cre/Lox, and RNAiTagsExpressionMammalianMutationPromoterhuman synapsinAvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-PURO-LoxP-SNAP-TERT
Plasmid#71390PurposeHomologues recombination donor plasmid for inserting a FLAG-SNAP-tag at the N-terminus of the TERT locus in human cells. Includes PURO resistance flanked by LoxP sites for selection.DepositorInsertTERT (TERT Human)
UseHr donorTagsFLAG-SNAPExpressionMutationPromoterEndogenous TERT promotorAvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-GFP-LoxP-SNAP-TERT
Plasmid#71391PurposeHomologues recombination donor plasmid for inserting a FLAG-SNAP-tag at the N-terminus of the TERT locus in human cells. Includes GFP marker flanked by LoxP sites for selection.DepositorInsertTERT (TERT Human)
UseHr donorTagsFLAG-SNAPExpressionMutationPromoterEndogenous TERT promotorAvailabilityAcademic Institutions and Nonprofits only -
pFUGW-FerH-ffLuc2-eGFP
Plasmid#71393PurposeLentiviral vector of luciferase-eGFP fusion gene driven by FerH promoterDepositorInsertFerH-ffLuc2-eGFP
UseLentiviralTagsExpressionMammalianMutationPromoterFerHAvailabilityAcademic Institutions and Nonprofits only -
pFUGW-Pol2-ffLuc2-eGFP
Plasmid#71394PurposeLentiviral vector of luciferase-eGFP fusion gene driven by Pol2 promoterDepositorInsertPol2-ffLuc2-eGFP
UseLentiviralTagsExpressionMammalianMutationPromoterPol2 (mouse RNA polymerase II gene promtoer)AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1alpha-2xGFP:NES-IRES-2xRFP:NLS
Plasmid#71396Purpose2Gi2R assayDepositorInserts2xGFP:NES
2xRFP:NLS
UseLentiviralTagsIRESExpressionMammalianMutationPromoterEF1alpha and IRESAvailabilityAcademic Institutions and Nonprofits only -
HR-TERT-SV40-GFP
Plasmid#71397PurposeHomologues recombination donor plasmid fo the TERT promotor region introducing a SV-40 driven GFP marker in the TERT promotor. Includes 1kb of TERT coding region in right homologues arm.DepositorInsertTERT (TERT Human)
UseTagsSV-40 GFP insertion in TERT promotorExpressionMutationPromoterEndogenous TERT promotorAvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA
Plasmid#71409PurposeThere is no gene/insert. It is a backbone plasmid that others can use to insert sgRNAs of interest. The cloning site for this BsmBIDepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pHBV-Luc
Plasmid#71414PurposeTo see the activity of HBV transcription using Luciferase assayDepositorInsertHBV core promoter, enhancer I, enhancer II and luciferase
UseLuciferaseTagsExpressionMammalianMutationPromoterHBVAvailabilityAcademic Institutions and Nonprofits only -
pHBV-S1-Luc
Plasmid#71416PurposeTo see S1 promoter activity of HBV for luciferase assayDepositorInsertHBV S1 promoter driving Luciferase expression
UseLuciferaseTagsExpressionMammalianMutationPromoterHBV S1AvailabilityAcademic Institutions and Nonprofits only -
pHBV-S2-Luc
Plasmid#71417PurposeTo see HBV S2 promoter activity for luciferase assayDepositorInsertHBV S2 promoter driving luciferase expression
UseLuciferaseTagsExpressionMammalianMutationPromoterHBV S2AvailabilityAcademic Institutions and Nonprofits only -
pHBV-X/EnhI-Luc
Plasmid#71418PurposeTo see HBV X promoter(overlaped EnhanceI) activity for luciferase assayDepositorInsertHBV X promoter and enhancer I driving Luciferase expression
UseLuciferaseTagsExpressionMammalianMutationPromoterHBV XAvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
UseTagsExpressionMutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …PromoterAvailabilityAcademic Institutions and Nonprofits only -
pmGFP10C-Tau
Plasmid#71433PurposeSplit GFP plasmid for visualization of Tau dimerization. Used together with plasmid 71434DepositorInsertTau (0N4R) (MAPT Human)
UseTagsGFP (1-212)ExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pmGFP11C-Tau
Plasmid#71434PurposeSplit GFP plasmid for visualization of Tau dimerization. Used together with plasmid 71433DepositorInsertTau (0N4R) (MAPT Human)
UseTagsGFP (213-228)ExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only
Showing: 9641 - 9660 of 18097 results