-
Plasmid#166083PurposePlasmid for constitutive spCas9 and tet-inducible PPE1 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertPPE1 (PPE1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_GAL2
Plasmid#166088PurposePlasmid for constituive spCas9 and tet-inducible GAL2 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertGAL2 (GAL2 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRARB.1.0-gDNA
Plasmid#132471PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertRARB (RARB Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
UCT1m
Plasmid#121041PurposeMoClo golden gate assembly DE part for gQi gRNA (guide RNA for S. pyogenes Cas9; sequence from DOI: 10.1016/j.cell.2013.02.022). Please see Supplemental Documents for annotated Genbank file.DepositorInsertUCT-part guide RNA (Stanley Qi sequence)
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
C114m
Plasmid#121013PurposeMoClo golden gate assembly CD part for Cas9 (S. pyogenes gRNA-targeted endonuclease Cas9, with bbsI cut sites removed synonymously). Please see Supplemental Documents for annotated Genbank file.DepositorInsertdCas9 with no bbsI or BsaI sites
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML104-KanMx4
Plasmid#83476PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains KanMx4 marker for yeast transformation.DepositorInsertKanMX4
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4
Plasmid#83475PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains HphMx4 marker for yeast transformation.DepositorInsertHphMX4
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pECNUS4
Plasmid#184887PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-NatMx3
Plasmid#83477PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains NatMX3 marker for yeast transformation.DepositorInsertNatMx3
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6 (RNA Pol III)Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAG1guide_RUBY_EggCas9
Plasmid#225983PurposeTo make mutant alleles of AtAGAMOUS1 gene in Arabidopsis thaliana. The transgenics can be selected by red color appearance of plantsDepositorInsertGuide RNA against AtAGAMOUS1
UseCRISPRTagsExpressionPlantMutationPromoter35s promoter to Drive RUBY and DD45p to drive Cas9Available sinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS2
Plasmid#184885PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXR004_puroR
Plasmid#219820PurposehU6-driven pre-gRNA plasmid for CasRx applications with puromycin resistance. 5' processed DR followed by BbsI sites for guide cloning (Adapted from plasmid #10954)DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJ1-g1g2-K2
Plasmid#218217PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAs, MoClo compatibleDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS3
Plasmid#184886PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS1
Plasmid#184884PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRPS5AAvailable sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK7-g7g8-K8
Plasmid#218220PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK3-g3g4-K4
Plasmid#218218PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK5-g5g6-K6
Plasmid#218219PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgMETTL16-2-Hygromycin
Plasmid#196200Purposeknockout METTL17DepositorInsertsgMETTL16-2 (METTL16 Human)
UseLentiviralTagsExpressionMutationNOPromoterAvailable sinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only