-
Plasmid#194247PurposeExpresses 3 miRNAs targeting human alpha-SynucleinDepositorInsertmiRaSynuclein(human) (SNCA Human)
UseAAV and RNAiTagsExpressionMutationPromoterCAGAvailable sinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_SpCas9_USP7 Exon 3 gRNA
Plasmid#131257PurposepX330-U6-Chimeric_BB-Cbh-hSpCas9 vector expressing a guide RNA targeting exon 3 of USP7DepositorInserthumanised S. pyogenes Cas9 nuclease
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-A6
Plasmid#185506PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionTagsExpressionMutationFSIENIM to AAAAAAMPromoterAvailable sinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
LEP-shTADA1.1226
Plasmid#105567Purposeretrovirally express TADA1 shRNA with puro resistance and GFP markerDepositorInsertTADA1 shRNA
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterMSCV-LTRAvailable sinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
sg14x(MS2) MUC4.1
Plasmid#101153PurposegRNA with 14 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
sg2.02 16x(MS2) MUC4.1
Plasmid#101154PurposegRNA with 16 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRelA'
Plasmid#175595PurposeTet inducible, KAN Resistant, non labelled synthesis domain of the E. coli relA gene on a low copy backbone. Used to induce controllable synthesis of ppGpp in E. coli.DepositorInsertCatalytic domain of E.coli relA gene.
UseTagsExpressionBacterialMutationOnly the catalytic domain of the enzyme is used (…PromoterAvailable sinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
gRNA-ura-HYB
Plasmid#64330Purposeura3 deletion gRNA cassette carried by pRS42HDepositorInsertgBlock product of ura3 deletion gRNA cassette
UseTagsExpressionYeastMutationPromoterAvailable sinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMesh1
Plasmid#175594PurposeLac inducible, AMP Resistant, non labelled gene mesh1 from D. melanogaster on a low copy backbone. Used to induce controllable hydrolysis of ppGpp in E. coli.DepositorInsertMesh1 (Mesh1 Fly)
UseTagsExpressionBacterialMutationCodon optimized for translation in E.coli. AGGAGG…PromoterAvailable sinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
sg2.02 MUC4.1
Plasmid#101152PurposegRNA with two MCP binding sitesDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromotermU6Available sinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-PRMT9 L182A/D183A/I184A/G185A
Plasmid#67608Purposebacterial expression of catalytically inactive GST-PRMT9 LDIG(182-185)AAAA mutantDepositorInsertPRMT9 (PRMT9 Human)
UseTagsGSTExpressionBacterialMutationcatalytic mutant LDIG(182-185)AAAAPromotertacAvailable sinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-41_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211681PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-41 guide RNA vector
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-AB4
Plasmid#185513PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionTagsExpressionMutationIDILGE replaced with AAAAAAPromoterAvailable sinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-AB2
Plasmid#185512PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionTagsExpressionMutationIDIL replaced with AAAAAAPromoterAvailable sinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-A6-myc
Plasmid#185507PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionTagsmycExpressionMutationFSIENIM to AAAAAAMPromoterAvailable sinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRelA*
Plasmid#175590PurposeTet inducible, KAN Resistant, fluor labelled (YFP) synthesis domain of the E. coli relA gene on a low copy backbone. Used to induce controllable synthesis of ppGpp in E. coli.DepositorInsertCatalytic domain of E.coli relA gene.
UseTagsFused with a flexible GS linker to mVenusExpressionBacterialMutationOnly the catalytic domain of the enzyme is used (…PromoterAvailable sinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMesh1*
Plasmid#175591PurposeLac inducible, AMP Resistant, fluor labelled (CFP) gene mesh1 from D. melanogaster on a low copy backbone. Used to induce controllable hydrolysis of ppGpp in E. coli.DepositorInsertMesh1 (Mesh1 Fly)
UseTagsFused with a flexible GS linker to ceruleanExpressionBacterialMutationCodon optimized for translation in E.coli. AGGAGG…PromoterAvailable sinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
PBLO CasX-gRNA
Plasmid#126419PurposeE. coli vector for CasX gRNA --- Used for In Vitro TranscriptionDepositorInsertcasX gRNA
UseCRISPR; In vitro transcriptionTagsExpressionMutationPromoterAvailable sinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
MIS18BP1 F9.1 gRNA
Plasmid#90768Purpose3rd generation lentiviral gRNA plasmid targeting human MIS18BP1DepositorInsertMIS18BP1 (Guide Designation F9.1)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only