We narrowed to 15,732 results for: LEA
-
Plasmid#187966Purposeexpresses HP1 with C-terminal tags ECFP and SNAPDepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pMKO.1-shBirc5
Plasmid#160949PurposeBirc5 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-F-API5
Plasmid#157662PurposeExpresses API5 in mammalian cellDepositorAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
MO70 - Orai1 EC-Flag
Plasmid#79590PurposeTransient expression and retroviral ExpressionDepositorInsertOrai1 (ORAI1 Human)
UseRetroviralTagsFLAG (inserted between TM3 and TM4 of the protein…ExpressionMammalianPromoterCMVAvailable SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFPN1-N-gamma-tubulin (1-333)
Plasmid#87858PurposeFluorescent fragment of gamma-tubulin that lacks gamma-tubulin DNA binding domain and NLSDepositorInsertgamma-tubulin 1 (TUBG1 Human)
TagsGFPExpressionMammalianMutationFragment from aa 1 to 333Available SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-Lyn-EGFP
Plasmid#196875PurposeNeuron-specific expression of LynGFP reporterDepositorInsertLynEGFP
UseCre/LoxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSOMA-T679A-NES
Plasmid#118940PurposeUsed to express the T679A mutant form of the SOMA FRET sensor with a nuclear exclusion signal in Arabidopsis thalianaDepositorInsertSOMA Sensor for Arabidopsis MAPK activity with T679A Mutation and Nuclear Exclusion Signal
ExpressionPlantAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc MOB1 T74A
Plasmid#47939Purposeexpresses Myc tagged human MOB1 containing T74A mutationDepositorAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET28b-API5
Plasmid#157655PurposeExpresses API5 in E.coli cellDepositorAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ oDam_f_GFPoNLS
Plasmid#85819PurposeiDamID plasmid. To express transiently the optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertoDam_f_GFPoNLS
TagsoNLS (optimized nuclear localization signal) C te…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-Hook2
Plasmid#198524PurposeExpression of GAL4 DNA-binding domain (BD)-Hook2 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertHook2 (HOOK2 Human)
TagsGAL4-DNA binding domain fragmentExpressionYeastMutationHis488Gln substitutionPromoterADH1Available SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-MKL1 D301-380
Plasmid#19852DepositorAvailable SinceDec. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-YOD1-MutS2
Plasmid#85667PurposeExpression of human YOD1 I292Q V295Q mutant with N-terminal GFP tagDepositorAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-V5-Emerin
Plasmid#120246PurposeExpresses V5-tagged Emerin in lentiviral vectorDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
HOXB1 (human) HIS-tag pET
Plasmid#8520DepositorAvailable SinceJuly 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
pBabe-ER-E2F2-dRb
Plasmid#62805Purposeexpresses an inducible E2F2 mutant that lacks the Rb binding domainDepositorInsertE2F2 (E2F2 Human)
UseRetroviralTagsHA-ErExpressionMammalianMutationdeletion of amino acids 302-437, including the Rb…Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA(MS2)_zeo_hPDX1_promoter_guide1
Plasmid#176838PurposeTo induce human PDX1 expression by recruiting SAM complex to PDX1 promoterDepositorInsertsgPDX1
ExpressionMammalianPromoterU6Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSN69
Plasmid#100125Purposeexpresses putative cMYC DBD with a HA tagDepositorInsertmCerulean-P2A-putative cMYC DBD with a HA tag (MYC Human)
UseLentiviralExpressionMammalianMutationInsert corresponds to the DBD of cMYCAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only