-
Plasmid#138461Purposelenti sgRNA cloning backbone with MS2 loops and EF1a-MCP-VP64DepositorInsertMCP-VP64-IRES-zsGreen1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1AAvailable sinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dCas9-KRAB-gRNA-TRE-blast
Plasmid#201152PurposeLentiviral expression of S. pyogenes dead Cas9 (dCas9/dSpCas9/SpdCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsdCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: TACGTTCTCTATCACTGATPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKL038 Lenti U6 dCas12a gRNA Puro mCherry
Plasmid#195546PurposedCas12a gRNA expression backboneDepositorInsertLenti U6- empty cassette_Direct repeat_puro_mcherry
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-dSaCas9-VP64-pU6-sgRNA
Plasmid#158990PurposeVector G encodes pAAV-pCMV-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in mammalian cellsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterpCMVAvailable sinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(MS2)_EF1a-MS2-P65-HSF1
Plasmid#92120PurposeExpression plasmid for both MS2-P65-HSF1 activator helper complex and sgRNA with two MS2 loops at tetraloop and stemloop 2 contains BsaI sites for insertion of spacer sequences.DepositorInsertMS2-P65-HSF1 (HSF1 Human, Synthetic)
UseCRISPRTagsExpressionMammalianMutationPromoterEF1aAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-control sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179120PurposeExpresses control sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertcontrol sgRNA
UseAAVTagsExpressionMutationPromoterU6Available sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX552-EF1a-DIO-mcherry(with gRNA scaffold)
Plasmid#199581PurposeExpresses mCherry in a Cre-dependent mannerDepositorInsertmCherry
UseAAV, CRISPR, and Cre/LoxTagsExpressionMammalianMutationPromoterEF1a intron A and U6Available sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
B52 (empty plasmid backbone to express 2 sgRNAs)
Plasmid#100708PurposeEmpty plasmid backbone to express 2 sgRNAs (use BbsI and BsmBI for cloning)DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterU6 promotersAvailable sinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pM123: pAAV-EFS-CasRx-control presgRNA
Plasmid#166871PurposeAAV vector for expressing CasRx and control presgRNA for RNA-editingDepositorInsertsU6-control presgRNA
RfxCas13d
UseAAV and CRISPRTagsHA and NLSExpressionMammalianMutationPromoterEFS and U6Available sinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-Ezr sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179119PurposeExpresses Ezr sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertEzr sgRNA
UseAAVTagsExpressionMutationPromoterU6Available sinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTol2-hsp70l:Cas9-t2A-GFP, 5xU6:sgRNA
Plasmid#108871PurposeExpression of heat shock inducible Cas9-GFP and U6-driven 5 individual gRNAs for scGESTALT in zebrafishDepositorInserts5xU6:sgRNA
Cas9-t2A-GFP
UseCRISPRTagsExpressionMutationPromoterU6 and hsp70Available sinceApril 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDAS12230_pegRNA-PEAR-GFP(10PBS-24RT)-mCherry
Plasmid#177182Purposeplasmid expressing a pegRNA targeting the PEAR-GFP plasmid along with an mCherry markerDepositorInsertpegRNA targeting the PEAR-GFP plasmid
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
Plasmid#165450PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoterDepositorInsertsdCas9N-IntN
3x Opn1mw promoter-targeting sgRNAs
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterU6 and short human rhodopsin promoterAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP64-pU6-sgRNA
Plasmid#158972PurposeVector C encodes pAAV-pMecp2-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterpMecp2Available sinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS654 All-in-One AAV-sgRNA-hNmeCas9
Plasmid#112139PurposeDelivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing.DepositorInsertssgRNA scaffold
Human-codon-optimized NmeCas9
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMammalianMutationPromoterU1a and U6Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEM047 [T7-assisted CROPseq sgRNA expression vector]
Plasmid#224899PurposeLentiviral CROP-seq vector with lineage barcode cassette and T7 promoter for ID amplification from cDNADepositorInsertseGFP
LacZ fragment (removed by digestion with BstXI/BlpI for sgRNA cloning)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-KRAB-pU6-sgRNA
Plasmid#158988PurposeVector E encodes pAAV-pMecp2-dSaCas9-KRAB-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-KRAB
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterpMecp2Available sinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-gRNA-UbC-eGFP-P2A-Bsr
Plasmid#83925PurposeLentiviral SpCas9-gRNA expression vector with eGFP-P2A-BlastRDepositorInsertseGFP
Bsr
UseCRISPR and LentiviralTagsP2AExpressionMutationPromoterhUbCAvailable sinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only