-
Plasmid#85845PurposeDonor plasmid for SNCA exon2 wild type sequence. Also contains TagBFP and EGFPDepositorInsertSNCA exon 2 homology arms (SNCA Human)
UseTags-ExpressionBacterial and MammalianMutation-PromoterAvailable sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
KG#84
Plasmid#110878PurposeExpresses the C. elegans acy--1 P260S gain-of-function cDNA in ventral cord cholinergic motor neuronsDepositorInsertsunc-17beta promoter
acy-1 P260S gain-of-function cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
UseTagsExpressionBacterialMutationChanged Proline to Serine at amino acid 260PromoterAvailable sinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#81
Plasmid#110876PurposeExpresses the C. elegans acy-1 P260S gain-of-function cDNA in body wall muscleDepositorInsertsmyo-3 promoter
acy-1 P260S gain-of-function cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
UseTagsExpressionBacterialMutationChanged Proline to Serine at amino acid 260PromoterAvailable sinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#205
Plasmid#110881PurposeExpresses the C. elegans pde-4 (isoform d) D448N cDNA pan-neuronallyDepositorInsertsrab-3 promoter
pde-4d (isoform d) D448N cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
UseTagsExpressionBacterialMutationchanged Asp 448 to AsnPromoterAvailable sinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#83
Plasmid#110877PurposeExpresses the C. elegans acy--1 P260S gain-of-function cDNA pan-neuronallyDepositorInsertsrab-3 promoter
acy-1 P260S gain-of-function cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
UseTagsExpressionBacterialMutationChanged Proline to Serine at amino acid 260PromoterAvailable sinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-SNCAe3-A53T
Plasmid#85848PurposeDonor plasmid for SNCA exon3 A53T sequence. Also contains EGFP and tagBFPDepositorInsertSNCA exon 3 homology arms (SNCA Human)
UseTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPLP1.3
Plasmid#22615DepositorInsertProteolipid Protein
UseE. coli phagemid vectorTagsExpressionMutationPromoterAvailable sinceNov. 24, 2009AvailabilityAcademic Institutions and Nonprofits only -
-
pChimera
Plasmid#61476PurposeVector for conventional cloning that contains AtU6-26 promoter and sgRNA backboneDepositorInsertU6-26:sgRNA
UseCRISPRTagsExpressionPlantMutationPromoterU6-26Available sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Drp1(A395D)-StrepII
Plasmid#174430PurposeExpresses human Drp1 Isoform 3 with A395D mutation in bacteriaDepositorInsertDrp1
UseTagsStrepIIExpressionBacterialMutationA395DPromoterT7Available sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Drp1-StrepII
Plasmid#174428PurposeExpresses human Drp1 Isoform 3 in bacteriaDepositorInsertDrp1
UseTagsStrepIIExpressionBacterialMutationNonePromoterT7Available sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCW01
Plasmid#72300PurposeStarting substrate for in vitro DNA mismatch repair substrate monitored by PstI cleavage. Derived from pUC19CPDrev H. HWang and J.B. Hays 2002 JBC 277:26136.DepositorTypeEmpty backboneUseDerivative of puc19TagsExpressionBacterialMutationPromoterlacAvailable sinceAug. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSCW02
Plasmid#72301PurposeStarting substrate for in vitro DNA mismatch repair substrate monitored by FauI cleavage. Derived from pUC19CPDrev H. HWang and J.B. Hays 2002 JBC 277:26136.DepositorTypeEmpty backboneUseDerivative of puc19TagsExpressionBacterialMutationPromoterlacAvailable sinceAug. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10873
Plasmid#183961PurposeU6-SKSKSO(crRNA array)-CAG-hyperdCas12a-HA-miniVPRDepositorInsertsHyperdCas12a
poly-crRNA array targeting Sox2-Klf4-Oct4
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…PromoterAvailable sinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pExodus CMV.Artemis
Plasmid#40211PurposeMammalian expression of codon-optimized Artemis.DepositorInsertArtemis (DCLRE1C Human)
UseTagsExpressionBacterial and MammalianMutationPromoterCMV and T7Available sinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-PTRE-tight-flex-hM3Dq-mCherry-WPRE-pA
Plasmid#115161PurposeThis plasmid is for use with neuronal cell-type selective activity tagging. The hM3Dq receptor expression requires both neural activity and Cre recombinase.DepositorInsertsPTRE - tet activator responsive promoter
flex sequence
hM3dq-mCherry (inverted)
flex sequence
UseAAVTagshM3Dq-mCherryExpressionMammalianMutationPromoterAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-actin prom-dsRed-adra2a.1227.shRNA
Plasmid#67880Purposeexpresses dsRed and shRNA to knock down adra2a receptorsDepositorInsertdsRed and shRNA to knock down the mouse adra2 receptor
UseAAVTagsExpressionMammalianMutationPromoterchicken beta actinAvailable sinceSept. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
hTph2p-Luc
Plasmid#223526PurposeFirefly-luciferase reporter expression driven by human Tph2 promoterDepositorInsertTph2 promoter (TPH2 Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationPromoterhTph2 promoterAvailable sinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-DIO-GCaMP6s
Plasmid#184284PurposeExpresses GCaMP6s in genetically defined neurons expressing Cre recombinaseDepositorInsertCCaMP6s
UseAAV, Cre/Lox, and Mouse TargetingTagsEGFPExpressionMammalianMutationPromoterhuman synaptophysinAvailable sinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDe-CAS9-D10A
Plasmid#61477Purposebased on pDe-CAS9, encodes Cas9 D10A nickase variantDepositorInsertCas9-D10A
UseCRISPRTagsExpressionPlantMutationcatalytic Asp10 changed to AlaPromoterPcUbi4-2Available sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Drp1-EGFP-StrepII
Plasmid#174429PurposeExpresses human Drp1 Isoform 3 with EGFP at C-terminus in bacteriaDepositorInsertDrp1
UseTagsEGFP-StrepIIExpressionBacterialMutationNonePromoterT7Available sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
6xHis(TEV)-Drp1-StrepII
Plasmid#174422PurposeExpresses human Drp1 Isoform 3 in bacteriaDepositorInsertDrp1
UseTags6xHis(TEV) and StrepIIExpressionBacterialMutationNonePromoterT7Available sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEn-Chimera
Plasmid#61432PurposeGateway-Entry vector containing AtU6-26 promoter and sgRNA backboneDepositorInsertAtU6-26:sgRNA
UseCRISPRTagsExpressionPlantMutationPromoterAtU6-26Available sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDe-CAS9
Plasmid#61433PurposeBinary expression vector with A.th. codon-optimized Cas9 and Gateway destination sequenceDepositorInsertCas9
UseCRISPRTagsExpressionPlantMutationPromoterPcUBI4-2Available sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-TPC
Plasmid#61478PurposeBinary expression vector with A.th. codon-optimized Cas9 for conventional cloningDepositorInsertCas9
UseCRISPRTagsExpressionPlantMutationPromoterPcUbi4-2Available sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
6xHis(TEV)-yDrp1-StrepII
Plasmid#174427PurposeExpresses S. pombe Drp1 in bacteriaDepositorInsertDrp1
UseTags6xHis(TEV) and StrepIIExpressionBacterialMutationNonePromoterT7Available sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
6xHis(TEV)-Drp1(K38A)-StrepII
Plasmid#174423PurposeExpresses human Drp1 Isoform 3 with K38A mutation in bacteriaDepositorInsertDrp1
UseTags6xHis(TEV) and StrepIIExpressionBacterialMutationK38APromoterT7Available sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
6xHis(Thrombin)-GFP(TEV)-Drp1-StrepII
Plasmid#174424PurposeExpresses human Drp1 Isoform 3 with EGFP at N-terminus in bacteriaDepositorInsertDrp1
UseTags6xHis(Thrombin)EGFP(TEV) and StrepIIExpressionBacterialMutationNonePromoterT7Available sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEn-C1.1
Plasmid#61479PurposeEncodes CRISPR sgRNA for Gateway or conventional cloning of 1-3 sgRNAs into pDe-CAS9 or pCAS9-TPCDepositorInsertAtU6-26:sgRNA
UseCRISPRTagsExpressionPlantMutationPromoterU6-26Available sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
6xHis(TEV)-Drp1(K569A,K571A)-StrepII
Plasmid#174426PurposeExpresses human Drp1 Isoform 3 with K569A, K571A mutations in bacteriaDepositorInsertDrp1
UseTags6xHis(TEV) and StrepIIExpressionBacterialMutationK569A, K571APromoterT7Available sinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
6xHis(TEV)-Drp1(K557A,K560A)-StrepII
Plasmid#174425PurposeExpresses human Drp1 Isoform 3 with K557A, K560A mutations in bacteriaDepositorInsertDrp1
UseTags6xHis(TEV) and StrepIIExpressionBacterialMutationK557A, K560APromoterT7Available sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
6xHis(TEV)-dDrp1-StrepII
Plasmid#174421PurposeExpresses D. melanogaster Drp1 in bacteriaDepositorInsertDrp1 (Drp1 Fly)
UseTags6xHis(TEV) and StrepIIExpressionBacterialMutationNonePromoterT7Available sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK317
Plasmid#72472Purposepuc118 modified to contain ribosome binding siteDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterlacAvailable sinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pD2_miniluc_newP7
Plasmid#174105Purposeadding the mini luciferase and mini promoter to the MPRA lenti constructDepositorInsertmini luciferase mini-promoter
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-GCaMP6s
Plasmid#183809Purposehis plasmid is for use with neuronal cell-type selective activity tagging. The GCaMP6 expression requires both neural activity and Cre recombinase.DepositorInsertAAV transgene TetO promoter-DIO/flex-GCaMP6
UseAAV, Cre/Lox, and Mouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-hM4Di-mCherry
Plasmid#182532PurposeThis plasmid is for use with neuronal cell-type selective activity tagging. The hM4Di receptor expression requires both neural activity and Cre recombinase.DepositorInsertAAV transgene - hSyn promoter-tet-flex-hM4Di-cherry
UseAAV, Cre/Lox, and Mouse TargetingTagshM4Di-mCherryExpressionMammalianMutationPromotertetO promoterAvailable sinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-ChR2-EYFP
Plasmid#183765PurposeThis plasmid is for use with neuronal cell-type selective activity tagging. The ChR2-EYFP expression requires both neural activity and Cre recombinase.DepositorInsertAAV transgene -teto promoter-flex/dio-ChR2-EYFP
UseAAV, Cre/Lox, and Mouse TargetingTagsChR2-EYFPExpressionMammalianMutationPromotertetO promoterAvailable sinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11
Plasmid#157970PurposeAAV vector plasmid containing the Chimeric CMV/Chicken Beta Actin promoter driving 'humanized' GFPDepositorHas ServiceAAV.A01.T, AAV.A02.T, AAV.A03.T, AAV.A04.T, AAV.A05.T, AAV.A06.T, AAV.A07.T, AAV.A08.T, AAV.A09.T, AAV.A10.T, AAV.A11.T, and AAV.A12.TInsert'humanized' e.g. codon optimized GFP
UseAAVTagsExpressionMutationPromoterchimeric CMV/Chicken Beta actin (CBA)Available sinceOct. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-Casp3-TEV
Plasmid#183766PurposeThis plasmid is for use with neuronal cell-type selective activity tagging. The Caspase3 expression requires both neural activity and Cre recombinase.DepositorInsertAAV transgene - tetO promoter-flex/DIO-Caspase3-TEV
UseAAV, Cre/Lox, and Mouse TargetingTagsExpressionMammalianMutationPromotertetO promoterAvailable sinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUNos_C1
Plasmid#33297DepositorTypeEmpty backboneUsePlant expressionTagsExpressionMutationPromotermaize ubiquitin (Ubi-1)Available sinceDec. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBD026
Plasmid#201309PurposeAvrSr27-2 as Golden Gate compatible MoClo CDS partDepositorInsertAvrSr27-2
UseTagsExpressionPlantMutationremoval of BsaI and BpiI sitesPromoterAvailable sinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLM001
Plasmid#201311PurposeAvrSr50 (with stop codon) as Golden Gate compatible MoClo CDS partDepositorInsertAvrSr50
UseTagsExpressionPlantMutationremoval of BsaI and BpiI sitesPromoterAvailable sinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLM002
Plasmid#201312PurposeAvrSr50 (no stop codon) as Golden Gate compatible MoClo CDS partDepositorInsertAvrSr50
UseTagsExpressionPlantMutationremoval of BsaI and BpiI sitesPromoterAvailable sinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBD025
Plasmid#201308PurposeAvrSr27-1 as Golden Gate compatible MoClo CDS partDepositorInsertAvrSr27-1
UseTagsExpressionPlantMutationremoval of BsaI and BpiI sitesPromoterAvailable sinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBD027
Plasmid#201310PurposeavrSr27-3 as Golden Gate compatible MoClo CDS part (no recognition by Sr27)DepositorInsertavrSr27-3
UseTagsExpressionPlantMutationremoval of BsaI and BpiI sitesPromoterAvailable sinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFloxed DHFR-TS*
Plasmid#100605PurposepUC19 with loxP-pDHFR-TS:DHFR-TS*(Pyr-R)-Stop-loxP-DHFR-TS 3' UTRDepositorInsertFloxed TgDHFR-TS*
UseToxoplasma expressionTagsExpressionMutationPyrimethamine resistancePromoterAvailable sinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
Rich-pT7
Plasmid#108445PurposeThis plasmid is useful for in vitro transcription of genes using T7 promoter. Can be used for Xenopus oocyte assay. It is derived from pUC57. Xenopus globin 3UTR and 5UTR, pT7, and polyA added.DepositorTypeEmpty backboneUseTagsExpressionMutationPromoterpT7Available sinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only