AAV-actin prom-dsRed-adra2a.1227.shRNA
(Plasmid
#67880)
-
Purposeexpresses dsRed and shRNA to knock down adra2a receptors
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67880 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 7100
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedsRed and shRNA to knock down the mouse adra2 receptor
-
SpeciesG. gallus (chicken), Synthetic
-
Insert Size (bp)4000
- Promoter chicken beta actin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SbfI (unknown if destroyed)
- 3′ cloning site PacI (unknown if destroyed)
- 5′ sequencing primer TGCTAACCATGTTCATGCCTTC
- 3′ sequencing primer GACCCGGCAGCAGGCCGCGGGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe shRNA hairpin sequences were placed into the mir30 site of pPRIME-cmv-dsRed-FF3 (Addgene Plasmid 11664; gift from S. Elledge, Howard Hughes Medical Institute), and then subcloned into an AAV vector.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The shRNA hairpin sequences were placed into the mir30 site of pPRIME-cmv-dsRed-FF3 (Addgene Plasmid 11664; gift from S. Elledge, Howard Hughes Medical Institute). Inserts in pPRIME were released by SbfI and PacI digestion, and cloned into the PstI and PacI sites in the polylinker of the AAV-genome plasmid pAM-flex (Murray AJ et al.2011 Nat Neurosci 14, p297), to give ITR-cmv-Penhancer/chicken β-actin-dsRED-mir30-shRNA-woodchuck post-translational regulatory sequence (WPRE)-bovine growth hormone polyadenylation signal (pA)-ITR. The sh RNA knocks down mouse adra2a expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-actin prom-dsRed-adra2a.1227.shRNA was a gift from William Wisden (Addgene plasmid # 67880 ; http://n2t.net/addgene:67880 ; RRID:Addgene_67880) -
For your References section:
Neuronal ensembles sufficient for recovery sleep and the sedative actions of alpha2 adrenergic agonists. Zhang Z, Ferretti V, Guntan I, Moro A, Steinberg EA, Ye Z, Zecharia AY, Yu X, Vyssotski AL, Brickley SG, Yustos R, Pillidge ZE, Harding EC, Wisden W, Franks NP. Nat Neurosci. 2015 Apr;18(4):553-61. doi: 10.1038/nn.3957. Epub 2015 Feb 23. 10.1038/nn.3957 PubMed 25706476
Map uploaded by the depositor.