-
-
pT7-7 asyn S129A
Plasmid#36048DepositorInsertalpha-synuclein S129A (SNCA Human)
UseTagsExpressionBacterialMutationS129APromoterT7Available sinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
NgΔIQ FUNgDIQGW
Plasmid#92232PurposeLentiviral expression of human Ng with deletion mutationDepositorInsertNg (NRGN Human)
UseLentiviralTagsEGFPExpressionMammalianMutationdelta IQPromoterhUbCAvailable sinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP C1
Plasmid#202424PurposeEncodes GFP aloneDepositorTypeEmpty backboneUseLentiviralTagsExpressionMutationPromoterAvailable sinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE-eGFP-F1C
Plasmid#211457PurposeDox inducible delivery of eGFP fused to a flotillin-1 palmitoylation blocking peptide (F1C)DepositorInsertFlotillin-1-palmitoylation blocking peptide (FLOT1 Human)
UseLentiviralTagseGFPExpressionMammalianMutationNonePromoterAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-eGFP-F1A
Plasmid#211458PurposeDox inducible delivery of eGFP fused to a flotillin-1 palmitoylation mutant control peptide (F1A)DepositorInsertFlotillin-1-palmitoylation mutant control peptide (FLOT1 Human)
UseLentiviralTagseGFPExpressionMammalianMutationC34APromoterAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SPN-bio-His
Plasmid#51829PurposeExpresses full-length Leukosialin precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertSPN (SPN Human)
UseTagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
A2M-bio-His
Plasmid#53423PurposeExpresses full-length Alpha-2-macroglobulin precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertA2M (A2M Human)
UseTagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTET2-lucCP
Plasmid#198353PurposePart of Renilla reporter system, encodes Firefly luciferaseDepositorInsertFirefly Luciferase
UseLuciferaseTagsExpressionMammalianMutationPromoterpTET2Available sinceApril 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
-
pTV-Nanog_2-5prime-1000-24MS96T-3F_NeoR
Plasmid#174882PurposeTargeting vector for generating Nanog STREAMING-tag KI cellDepositorInsertSTREAMING-tag with homology arms for Nanog
UseMouse TargetingTagsExpressionMutationPromoterAvailable sinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
SERPINA-bio-His
Plasmid#52182PurposeExpresses full-length Alpha-1-antitrypsin precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertSERPINA (SERPINA1 Human)
UseTagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSP72-RBM8A-3'UTR AluY-Sz WT 2598-4066
Plasmid#175587Purposein vitro transcription of wt RBM8A 3'UTRDepositorInsertRBM8A-3'UTR AluY-Sz WT
UseIn vitro transcriptionTagsExpressionMutationPromoterT7Available sinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTH727-CEN-RLuc/staCFLuc
Plasmid#38211DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe last three codons of the full-length Firefly …PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-DD-3xFLAG-hSOX17-GS-TagBFP-BGHpA
Plasmid#172226PurposeExpression vector with Shield-1 stabilizable hSOX17 fused to TagBFP.DepositorInsertSOX17 (SOX17 Human)
UsePiggybac transposonTags3XFLAG, DD-domain, GS-linker, and TagBFPExpressionMammalianMutationPromoterCAGAvailable sinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUAST-SIK3 T196A
Plasmid#52974Purposeinsect expression of SIK3 T196A (LKB1 phosphorylation defective mutant)DepositorInsertSIK3 (Sik3 Fly)
UseTagsHAExpressionInsectMutationT196A LKB1 phosphorylation defective mutantPromoterHsp70Available sinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGWKS11
Plasmid#139418PurposeFluoroescent marker for use in Cryptococcus neoformans. Contains a codon optimised mNeonGreen marker.DepositorInsertmNeonGreen
UseTagsExpressionYeastMutationPromoterTEF1Available sinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Holiday Schedule: Addgene will be closing at 1:00 pm EST on November 27th and remain closed through the 29th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
How are we doing? Share feedback for a chance to win $50
Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more
Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more
