TRE-eGFP-F1A
(Plasmid
#211458)
-
PurposeDox inducible delivery of eGFP fused to a flotillin-1 palmitoylation mutant control peptide (F1A)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 211458 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLVX-BSD-tet
- Backbone size w/o insert (bp) 8011
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFlotillin-1-palmitoylation mutant control peptide
-
Alt nameF1A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)54
-
MutationC34A
-
GenBank IDNM_005803.4 NM_005803.4
-
Entrez GeneFLOT1
-
Tag
/ Fusion Protein
- eGFP (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TATGTCGAGGTAGGCGTGTA
- 3′ sequencing primer ctctaggcaccggatcaatt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bygene was delivered as a gBlock from IDT with 40bp homology ends compatible with gibson cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Sequence for F1A: ATGGTGGCTGGAGGGCGTGTCTTTGTCCTGCCCGCAATCCAACAGATCCAGAGGATCTAA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRE-eGFP-F1A was a gift from Linda DeGraffenried (Addgene plasmid # 211458 ; http://n2t.net/addgene:211458 ; RRID:Addgene_211458) -
For your References section:
Flotillin-1 palmitoylation is essential for its stability and subsequent tumor promoting capabilities. McClellan B, Wilson CN, Brenner AJ, Jolly CA, deGraffenried L. Oncogene. 2024 Mar;43(14):1063-1074. doi: 10.1038/s41388-024-02946-0. Epub 2024 Feb 19. 10.1038/s41388-024-02946-0 PubMed 38374406