TRE-eGFP-F1C
(Plasmid #211457)

• Purpose: Dox inducible delivery of eGFP fused to a flotillin-1 palmitoylation blocking peptide (F1C)
• Depositing Lab: Linda DeGraffenried
• Publication: McClellan et al Oncogene. 2024 Mar;43(14):1063-1074. doi: 10.1038/s41388-024-02946-0. Epub 2024 Feb 19.

Backbone

• Vector backbone: pLVX-BSD-tet
• Backbone size w/o insert (bp): 8011
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Flotillin-1-palmitoylation blocking peptide
• Alt name: F1C
• Species: H. sapiens (human)
• Insert Size (bp): 54
• Mutation: None
• GenBank ID: NM_005803.4 NM_005803.4
• Entrez Gene: FLOT1
• Tag / Fusion Protein:
  • eGFP (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TATGTCGAGGTAGGCGTGTA
• 3′ sequencing primer: ctctaggcaccggatcaatt

Resource Information

• A portion of this plasmid was derived from a plasmid made by: gene was delivered as a gBlock from IDT with 40bp homology ends compatible with gibson cloning

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Sequence for F1C: ATGGTGGCTGGAGGGCGTGTCTTTGTCCTGCCCTGCATCCAACAGATCCAGAGGATCTAA