-
Plasmid#1186DepositorInserthtt 103Q (HTT Human)
UseTagsGFPExpressionYeastMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
pPICZ-pre-Ost1-alphaf(I)-Btl2
Plasmid#117667PurposeStudy secretion efficiency of Btl2DepositorInsertpre-Ost1-alphaf(I)-Btl2
UseTagsExpressionYeastMutationThis plasmid encodes the lipase Btl2 together wit…PromoterpAOX1Available sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/S647A
Plasmid#74938PurposeMammalian expression of human NSF mutant S647A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
UseTagsFLAGExpressionMammalianMutationS647A (mutation in the D2 domain of the protein)PromoterCMVAvailable sinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1663 - pAAV SYN1 mGas6-Myc-DDK
Plasmid#202540PurposeAn adeno-associated viral vector expressing murine Gas6 fused Myc and DDK epitopes from a synapsin promoterDepositorInsertGas6 (Gas6 Mouse)
UseAAVTagsMyc-DDKExpressionMutationPromoterSYN1Available sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSUMO His6 SUMO SnRK2.6 (11-362)
Plasmid#177847PurposeBacterial Expression of SnRK2.6DepositorInsertSNF1-related protein kinase 2.6 (OST1 Mustard Weed)
UseTags6xHis-SUMOExpressionBacterialMutationPromoterAvailable sinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
SITS-EGFP-Bin1b
Plasmid#176021PurposeLeishmania cell free expression of zebrafish EGFP-Bin1b. Parton lab clone GRSDepositorInsertBin1b (bin1b Zebrafish)
UseLeishmania cell free expressionTagsEGFPExpressionMutationPromoterAvailable sinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T646A
Plasmid#74937PurposeMammalian expression of human NSF mutant T646A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
UseTagsFLAGExpressionMammalianMutationT646A (mutation in the D2 domain of the protein)PromoterCMVAvailable sinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T645A
Plasmid#74936PurposeMammalian expression of human NSF mutant T645A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
UseTagsFLAGExpressionMammalianMutationT645A (mutation in the D2 domain of the protein)PromoterCMVAvailable sinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLX_TRC311/NLS-Cas13d-P2A-Blast
Plasmid#212196PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-Blasticidin for RNA targeting. CasRx-2A-Blasticidin is driven by EF1a promoter. EGFP is driven by SV40DepositorInsertCasRx (NLS-RfxCas13d-NLS)-HA with 2A-Blasticidin
UseCRISPR and LentiviralTagsHA, NLS, and blasticidin S deaminaseExpressionMammalianMutationPromoterEF-1α promoterAvailable sinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHEE401E
Plasmid#71287PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
Plasmid#115694PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.DepositorInsertsNmeCas9
Nme-sgRNA
UseCRISPRTagsNLS and NLS, HAExpressionInsect and MammalianMutationNone and fusion of repeat/tracrRNA to make a sgRNAPromoterEF-1 alpha and U6Available sinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHEE401
Plasmid#71286PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertssgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 promoter and U6-26p Arabidopsis U6 gene pro…Available sinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-RANGAP.C-linker.miniIAA7.3xFlag.P2A.BSD
Plasmid#216248PurposeHDR template to tag endogenous human RANGAP1 C-terminus with miniIAA7.3xFlag.P2A.BSDDepositorInsertHDR template for human RANGAP1 (RANGAP1 Human)
UseCRISPR and TALEN; Hdr templateTagsminiIAA7.3xFlag.P2A.BSDExpressionMammalianMutationPromoterAvailable sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 hMOG-alpha1-EGFP
Plasmid#126463PurposeExpression a human MOG (isoform alpha1) EGFP fusion protein in mammalian cellsDepositorInsertMyelin oligodendrocyte glycoprotein (MOG Human)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
3'-ecRESCUE-mCherry
Plasmid#191486PurposeecDHFR DD-mCherry, an inducible ecRESCUE RNA base editor: TMP-induced ecDHFR DD expression allows reversible control of the expression of dRanCas13b-ADAR2-mCherryDepositorUseCRISPRTagsExpressionMammalianMutationPromoterCMVAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-SEC61B.N-BSD.P2A.miniIAA7.3xFlag
Plasmid#216250PurposeHDR template to tag endogenous human SEC61B N-terminus with BSD.P2A.miniIAA7.3xFlagDepositorInsertHDR template for human SEC61B (SEC61B Synthetic, HDR template, Human)
UseCRISPR; Hdr templateTagsBSD.P2A.miniIAA7.3xFlagExpressionMammalianMutationPromoterAvailable sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(MS2)_EF1a-MS2-P65-HSF1
Plasmid#92120PurposeExpression plasmid for both MS2-P65-HSF1 activator helper complex and sgRNA with two MS2 loops at tetraloop and stemloop 2 contains BsaI sites for insertion of spacer sequences.DepositorInsertMS2-P65-HSF1 (HSF1 Synthetic, Human)
UseCRISPRTagsExpressionMammalianMutationPromoterEF1aAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCSC-LHX8-IRES-GBX1
Plasmid#182235PurposeTo convert human skin fibroblasts into induced basal forebrain cholinergic neurons (hiBFCNs) in combination with ASCL1, Sox11, FGF2 and two small molecules, forskolin and LDN-193189DepositorUseLentiviralTagsExpressionMutationPromoterCMVAvailable sinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only