-
Plasmid#1186DepositorInserthtt 103Q (HTT Human)
UseTagsGFPExpressionYeastMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
H516 SONIC KrasG12D-IRES-luciferase donor
Plasmid#138178PurposeCRISPR SONIC: Kras G12D luciferase donor plasmid.DepositorInsertKrasG12D (Kras Mouse)
UseNhej donorTagsExpressionMutationPromoterAvailable sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3- sgAAVS1.5-CAG-Cas9-T2A-mCherry-P2A-Puro
Plasmid#216246PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and a highly efficient sgAAVS1.5 for AAVS1 integrationDepositorInsertCas9 and sgAAVS1.5
UseCRISPR; Human safe harbor locus (a avs1) site-spe…TagsExpressionMammalianMutationPromoterCAGAvailable sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSH-CAG-AtAFB2.F74A-mCherry-IRES-puro
Plasmid#216244PurposeExpress AtAFB2.F74A mutant with mCherry tag for AID2DepositorInsertAtAFB2.F74A-mCherry
UseCRISPR, TALEN, and Unspecified ; Human safe harbo…TagsmCherryExpressionMammalianMutationF74A mutationPromoterCAGAvailable sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-Ost1-alphaf(I)-E2-Crimson
Plasmid#117661PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpre-Ost1-alphaf(I)-E2-Crimson
UseTagsExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSYC-190
Plasmid#178962PurposeExpresses human GFAP (R79C) mutant fused to 3xFLAG tag in mammalian cellsDepositorInsertGlial fibrillary acidic protein (GFAP Human)
UseTags3xFLAGExpressionMammalianMutationR79CPromoterCMV IE94 PromoterAvailable sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEJS654 All-in-One AAV-sgRNA-hNmeCas9
Plasmid#112139PurposeDelivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing.DepositorInsertssgRNA scaffold
Human-codon-optimized NmeCas9
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMammalianMutationPromoterU1a and U6Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCVpic2neo-hTERT-p16 shRNA
Plasmid#164920PurposeExpresses hTERT cDNA and p16 shRNA in mammalian cellsDepositorUseRetroviralTagsHA tagExpressionMutationPromoterAvailable sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
SITS-mCherry-Bin1b
Plasmid#176025PurposeLeishmania cell free expression of zebrafish mCherry-Bin1b. Parton lab clone GSUDepositorInsertBin1b (bin1b Zebrafish)
UseLeishmania cell free expressionTagsmCherryExpressionMutationPromoterAvailable sinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-C2m2-SNAP
Plasmid#208791PurposeFor AAV production to express C2m2-SNAP in astrocytesDepositorInsertC2m2-SNAP (Mfge8 Mouse)
UseAAVTagsSNAP-tagExpressionMammalianMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterGFAP promoterAvailable sinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-PURO-LoxP-SNAP-TERT
Plasmid#71390PurposeHomologues recombination donor plasmid for inserting a FLAG-SNAP-tag at the N-terminus of the TERT locus in human cells. Includes PURO resistance flanked by LoxP sites for selection.DepositorInsertTERT (TERT Human)
UseHr donorTagsFLAG-SNAPExpressionMutationPromoterEndogenous TERT promotorAvailable sinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-C2m2-mKate
Plasmid#208793PurposeFor AAV production to express C2m2-mKate in astrocytesDepositorInsertC2m2-mKate (Mfge8 Mouse)
UseAAVTagsmKateExpressionMammalianMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterGFAP promoterAvailable sinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUB6-HuMGF
Plasmid#190782PurposeExpresses membrane-bound form of human SCF in mammalian cellsDepositorInserthuman stem cell factor (KITLG Human)
UseTagsExpressionMammalianMutationPromoterUbCAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
H513 px330.sgActin.UTR.2
Plasmid#138176PurposeCRISPR SONIC: Encodes codon-optimized SpCas9 and gRNA for targeting 3' UTR of β-actin.DepositorInsertsgActin (Actb Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_n-1] (GB1210)
Plasmid#75411PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_n-1]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [M1_n-1]
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGB2Ω2_SF-35s:hCas9:tNos (GB1103)
Plasmid#75400PurposeTranscriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter. Specially conceived to be linked with the TU of the kanamycin resistance gene GB1181.DepositorInserthCas9
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoter35SAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGB SF-35S:Renilla:TNOS-35S:P19:TNOS (GB0160)
Plasmid#75412PurposeModule for the expression of the Renilla Luciferase with the silencing suppressor P19DepositorInsertRenilla / P19
UseLuciferase and Synthetic BiologyTagsExpressionPlantMutationPromoter35SAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZE21/UBP1/ClpS
Plasmid#98566PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
ATP-dependent Clp protease adapter protein
UseTagsExpressionBacterialMutationIn a synthetic operon downstream of UBP1 and Remo…PromoterSame as UBP1 (operon) and Tet promoter (aTc induc…Available sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
NLS-HA-2xMCP-Ezh2
Plasmid#126590PurposeExpresses MCP (MS2 Coat Protein) fusion to Ezh2 in mammalian cells, lentiviral backboneDepositorInsert2XMCP-Ezh2 (Ezh2 Synthetic, Mouse)
UseLentiviralTagsNLS-HAExpressionMammalianMutationPromoterhuman ubiquitin C promoterAvailable sinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRTagsExpressionYeastMutationPromoterScTDH3Available sinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only