pZE21/UBP1/ClpS
(Plasmid
#98566)
-
PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and E. coli ClpS in an artificial operon
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98566 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepZE21
-
Backbone manufacturerExpressys
- Backbone size w/o insert (bp) 2200
- Total vector size (bp) 4696
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsNote that this plasmid does not contain the Tet repressor and thus inducible expression only occurs in hosts that express the Tet repressor (such as C321.deltaA strains)
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTruncated ubiquitin cleavase, codon optimized
-
Alt nameUBP1
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2151
-
MutationRemoved the first 98 amino acids that encode transmembrane domains to improve yield as was done in literature (Wojtowicz et al, Microb Cell Fact, 2005, DOI: 10.1186/1475-2859-4-17)
- Promoter Tet promoter (aTc inducer)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CCATTATTATCATGACATTAACC
- 3′ sequencing primer TATCACTTTATACATAGATG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameATP-dependent Clp protease adapter protein
-
Alt nameClpS
-
SpeciesEscherichia coli
-
Insert Size (bp)318
-
MutationIn a synthetic operon downstream of UBP1
- Promoter Same as UBP1 (operon)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CGACATTTCAGGGAAGGATG
- 3′ sequencing primer GGATTTGTCCTACTCAGGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS results found that the second tet operator in the tet promoter is missing; however the depositing laboratory confirmed that the plasmid functions normally
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZE21/UBP1/ClpS was a gift from George Church (Addgene plasmid # 98566 ; http://n2t.net/addgene:98566 ; RRID:Addgene_98566) -
For your References section:
Engineering posttranslational proofreading to discriminate nonstandard amino acids. Kunjapur AM, Stork DA, Kuru E, Vargas-Rodriguez O, Landon M, Soll D, Church GM. Proc Natl Acad Sci U S A. 2018 Jan 16;115(3):619-624. doi: 10.1073/pnas.1715137115. Epub 2018 Jan 4. 10.1073/pnas.1715137115 PubMed 29301968