-
Plasmid#224122PurposeMammalian expression of SpCas9 PE7 prime editor with P2A-BSD markerDepositorInsertPE7-P2A-BSD
UseTagsP2A-BSD, SV40 bpNLS, and c-Myc NLSExpressionMammalianMutationPromoterCMVAvailable sinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (AAV9)
Viral Prep#104492-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (#104492). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7f-WPRE plasmid DNA. Syn-driven, Cre-dependent GCaMP7f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-ArchT-tdTomato (AAV5)
Viral Prep#28305-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-FLEX-ArchT-tdTomato (#28305). In addition to the viral particles, you will also receive purified pAAV-FLEX-ArchT-tdTomato plasmid DNA. CAG-driven Cre-dependent ArchT-tdTomato expression for optogenetic neural inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomato (Cre-dependent)Available sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSL-Cas9-Rosa26TV
Plasmid#61408PurposeCre-dependent Cas9 expression plasmid and targeting vector for the mouse Rosa26 locus. Cas9 expression is Cre-dependent and the targeting vector has positive (Neo) and negative (DTA) selection.DepositorInsertsCas9
EGFP
UseCRISPR, Cre/Lox, and Mouse TargetingTags3xFLAG and P2AExpressionMammalianMutationhuman codon optimizedPromoterCAGAvailable sinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
Mouse sgRNA library Brie in lentiGuide-Puro (Lentiviral Prep)
Viral Prep#73633-LVPurposeReady-to-use Lentiviral Prep particles produced from Mouse sgRNA library Brie in lentiGuide-Puro (#73633). In addition to the viral particles, you will also receive purified Mouse sgRNA library Brie in lentiGuide-Puro plasmid DNA. <p><p>Ready-to-use lentiviral pooled library for CRISPR screening in mouse cells. Use on cells that are stably expressing Cas9 to make edits across 19,674 genes in the mouse genome.</p></p>DepositorPromoterTagsNoneAvailable sinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-axon-GCaMP6s (AAV1)
Viral Prep#111262-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSynapsin1-axon-GCaMP6s (#111262). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-axon-GCaMP6s plasmid DNA. Synapsin-driven, axon-targeted GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX602-AAV-TBG::NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6::BsaI-sgRNA
Plasmid#61593PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTagsHA, NLS, and OLLAS tagExpressionMammalianMutationPromoterAvailable sinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
UseTagsExpressionMammalianMutationPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available sinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET21a-alpha-synuclein
Plasmid#51486PurposeInducible expression of human alpha-synuclein in E.coliDepositorInsertalpha-synuclein (SNCA Human)
UseTagsExpressionBacterialMutationPromoterT7Available sinceMarch 31, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
3xAP1pGL3 (3xAP-1 in pGL3-basic)
Plasmid#40342DepositorInsert3xAP-1
UseLuciferaseTagsLuciferaseExpressionMammalianMutationContains three canonical AP-1 binding sites (TGAC…PromoterAvailable sinceSept. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pR26 CAG/GFP Asc
Plasmid#74285PurposeGene targeting vector for the mouse Rosa26 locus, including a CAG promoter, loxP flanked stop cassette and GFP, for cloning into AscIDepositorInsertRosa26 5-homology region
UseMouse TargetingTagsExpressionMutationPromoterAvailable sinceApril 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV G-CEPIA1er
Plasmid#58215PurposeGreen fluorescent indicator for calcium imaging in the endoplasmic reticulumDepositorInsertG-CEPIA1er
UseTagsmycExpressionMammalianMutationG-GECO1.1 E299D M304L D328N N345K F360W G369S E37…PromoterCMVAvailable sinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Lysosomes-20
Plasmid#55073PurposeLocalization: Lysosome Membrane, Excitation: 587, Emission: 610DepositorInsertLAMP1
UseTagsmCherryExpressionMammalianMutationPromoterCMVAvailable sinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pT3-EF1A-MYC-IRES-luc
Plasmid#129775PurposeTransposon based vector that expresses human MYC followed by IRES and firefly luciferaseDepositorInserthuman MYC (MYC Human)
UseTagsluciferaseExpressionMammalianMutationPromoterEF1AAvailable sinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
NFAT luciferase reporter
Plasmid#10959DepositorInsertIL-2 promoter (IL2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationPromoterAvailable sinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-KRAS-G12D
Plasmid#116423PurposeLentiviral expression of KRAS G12DDepositorInsertKRAS (KRAS Human)
UseLentiviralTagsExpressionMutationG12DPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-EGFP (BPK1098)
Plasmid#133962PurposeCMV and T7 promoter plasmid for EGFP expression in mammalian cells or for in vitro transcriptionDepositorInsertEGFP
UseTagsExpressionMammalianMutationPromoterCMV and T7Available sinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV.rTH.PI.Cre.SV40
Plasmid#107788PurposeAAV vector expressing Cre from rTH promoterDepositorHas ServiceAAV Retrograde and AAV9InsertCre
UseAAVTagsExpressionMammalianMutationPromoterrTHAvailable sinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
SPLICS Mt-ER Short P2A
Plasmid#164108PurposeDetect the short Mitochondria-Endoplasmic reticulum contactDepositorInsertSplit GFP Mt-ER Short P2A
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only