174,135 results
-
Viral Prep#162374-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-syn-jGCaMP8s-WPRE (#162374). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8s-WPRE plasmid DNA. Syn-driven expression of calcium sensor GCaMP8s (more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pCAG-Eco
Plasmid#35617DepositorInsertEcotropic MLV envelope
ExpressionMammalianAvailable SinceJuly 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 BRGI-Flag
Plasmid#19143DepositorInsertSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (SMARCA4 Human)
TagsFlagExpressionMammalianAvailable SinceSept. 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM4D(Gi)-mCherry (AAV1)
Viral Prep#44362-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-DIO-hM4D(Gi)-mCherry (#44362). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM4D(Gi)-mCherry plasmid DNA. hSyn-driven, Cre-dependent, hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available SinceMay 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP-Gal8
Plasmid#127191PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.DepositorInsertGFP-Gal8 (LGALS8 Human)
TagsGal8 is fused to the c-terminus of GFPExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-hNGN2
Plasmid#172115PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 expressionInsertsTagsT2A-mycNLS-mTagBFP2ExpressionMammalianPromoterEF1a and TRE3GAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MBP-ULK1-1-835-mcherry
Plasmid#249729PurposeExpressing human ULK1-1-835 with a MBP tag in N-terminal and a mcherry tag in C-terminalDepositorAvailable SinceMarch 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKD3
Plasmid#45604DepositorInsertFRT-cat-FRT
ExpressionBacterialPromoterR6KAvailable SinceJune 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCRIS-PITChv2-Puro-dTAG (BRD4)
Plasmid#91793PurposePITCh dTAG donor vector for Puro-P2A-2xHA-FKBP_F36V knock-in into the N-terminus of the human BRD4 locus.DepositorInsertPuro-P2A-2xHA-FKBP_F36V
UseCRISPRExpressionMammalianMutationPhenylalanine 36 to valine in FKBP12PromoterPromotorlessAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK793
Plasmid#8827DepositorInsertTEV protease, S219V mutant
TagsHis, MBP (with TEV), and polyarginineExpressionBacterialMutationS219V mutation (improves stability)Available SinceMay 24, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCH45 (multiAsCas12a-KRAB lenti)
Plasmid#217330PurposeLentiviral expression of multiAsCas12a-KRABDepositorInsertmultiAsCas12a
UseCRISPR and LentiviralTags6xMycNLS and HA-SV40NLS-XTEN80-KRAB-P2A-TagBFP2MutationR1226A/E174R/S542R/K548RPromoterUCOE-SFFVAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hSTING (R232)
Plasmid#214152PurposeTransient expression of STING R232DepositorAvailable SinceMarch 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFH2.10_Gag-MCP-P2A-eGFP
Plasmid#205525PurposeExpress HIV Gag-MCP-P2A-eGFPDepositorInsertGag-MCP
ExpressionMammalianMutationWTPromoterCMVAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM4D(Gi)-mCherry (AAV8)
Viral Prep#50475-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-hSyn-hM4D(Gi)-mCherry (#50475). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM4D(Gi)-mCherry plasmid DNA. hSyn-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
Olig001
Plasmid#170716PurposeOlig001 encodes a novel AAV capsid that exhibits preferential oligodendrocyte tropism in the CNSDepositorInsertOlig001 capsid gene / rep 2
UseAAVAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBdox-MEF2C-T2A-CEBPB-P2A-IRF8_PuroR
Plasmid#250292PurposePiggyBac integration of 3 transcription factors (MEF2C, CEBPB, IRF8) under a dox-inducible promoterDepositorInsertMEF2C-T2A-CEBPB-P2A-IRF8
ExpressionMammalianAvailable SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
FUW-M2rtTA
Plasmid#20342PurposeLentiviral plasmid expressing the reverse tetracycline transactivatorDepositorInsertM2rtTA
UseLentiviralExpressionMammalianAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-miniDq-mCherry-P2A-HA-KORD
Plasmid#204359PurposeAAV vector for coexpression of miniDq and KORD under the control of human synapsin promoterDepositorInsertminiDq-mCherry-P2A-HA-KORD
UseAAVTagsHA (for KORD) and mCherry (for miniDq)MutationFor miniDq, the third intracellular loop (ICL3) o…PromoterhSynAvailable SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only