We narrowed to 16,105 results for: grna
-
Plasmid#69297PurposeGolden Gate recipient and Gateway entry vector; assembly of 5 gRNAsDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
pSimpleII-U6-tracr-U6-crRNA(tdTomato)-NLS-NmCas9-HA-NLS(s)
Plasmid#47869PurposeAll-in-one plasmid targeting tdTomatoDepositorPublicationInsertsNmCas9
U6pr-tracrRNA
tdTomato crRNA
UseCRISPRTagsHA and NLSExpressionMammalianAvailable sinceSept. 30, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCASCADE-fabI-gltA1-gltA2-udhA-zwf-gapAP1
Plasmid#87149PurposefabI-gltA1-gltA2-udhA-zwf-gapAP1 targeting guide RNA E. coli, Low Phosphate InductionDepositorInsertfabI-gltA1-gltA2-udhA-zwf-gapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available sinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330A_D10A-1x5
Plasmid#58775PurposeExpresses Cas9 nickase and gRNADepositorInserthumanized S. pyogenes Cas9 (D10A) nickase
UseCRISPRTags3xFLAGExpressionMammalianMutationD10A nickase-converting mutationPromoterCBhAvailable sinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAC-U61-SapI
Plasmid#112808PurposegRNA cloning vector for expressing 1-3 gRNAs in DrosophilaDepositorTypeEmpty backboneExpressionBacterialAvailable sinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable sinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available sinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-PITCh-TUBA1B
Plasmid#207763PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of TUBA1B for knock-in.DepositorInsertsgRNA Targeting N-terminus of TUBA1B (TUBA1B Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJA54
Plasmid#60212Purposecleavage near e1350 locus in sqt-1DepositorInsertsqt-1(e1350) gRNA1
UseCRISPRPromoterU6Available sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
U6>Control(F+E)
Plasmid#60006PurposeU6 promoter driving control (F+E) sgRNADepositorInsertControl (F+E) sgRNA
UseCRISPRPromoterCiinte.U6Available sinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ERF922
Plasmid#126883PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Pi21
Plasmid#126904PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd (no NLS) g4+g10+g18 (FWA)
Plasmid#117168PurposeCRISPR Cas9 SunTag system to target NtDRMcd (without an NLS) to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_NLS_GB1_noNLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
plenti-px330-CRBN-T1-pGK-Pur
Plasmid#107382PurposeMammalian expression CRISPR/Cas9DepositorAvailable sinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCfB3405
Plasmid#106166PurposeEasyCloneYALI system-based yeast episomal vector carrying a nourseothricin-resistance marker for Yarrowia lipolytica, can be used for gRNA expression, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCFD4d-U6-1:white1-U6-3:white1
Plasmid#84005PurposepCFD4d expresses white sgRNA-1 from a U6:3 promoter and the same white sgRNA-1 from a U6:1 promoterDepositorInsertswhite sgRNA-1
white sgRNA-1
UseCRISPRPromoterU6:1, U6:3, and dU6-1; dU6-3Available sinceJan. 9, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAC1815_pCR8-gSMN2-DN3
Plasmid#118648PurposeTransient transfection; Expressed SMN2-DN3 CasRx gRNA; Gateway DonorDepositorInsertgSMN2-DN3
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
ABEmax-Puro V2
Plasmid#226955PurposeABEmax plasmid enabling A:T to G:C base editing using a single plasmid.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-hSt3Cas9 (pXK-1721)
Plasmid#208828PurposeCRISPR/hSt3Cas9 expression vector for Animal gene editing, harboring the humanized St3Cas9 gene and the corresponding optimized SP1.gRNA. Key Construct: mU6- SP1.gRNA-CMV-hSt3Cas9.DepositorTypeEmpty backboneUseCRISPR; Stcas9ExpressionMammalianPromoterCMVAvailable sinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only