We narrowed to 16,166 results for: grna
-
Plasmid#122659PurposeExpresses sgRNA for telomere repeats with fluorescent indicator BFP and puromycin selection markerDepositorInsertBFP
UseCRISPR and LentiviralExpressionMammalianAvailable sinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-NEAT1pr_v2
Plasmid#97082PurposeEncodes an sgRNA that creates a DSB at the promoter of human NEAT1 geneDepositorInsertsgRNA NEAT1pr_v2
UseCRISPRPromoterU6Available sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330A_dCas9-1x4
Plasmid#63598PurposeExpresses dCas9 and gRNADepositorInserthumanized S. pyogenes dCas9
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBhAvailable sinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330A_D10A-1x7
Plasmid#58777PurposeExpresses Cas9 nickase and gRNADepositorInserthumanized S. pyogenes Cas9 (D10A) nickase
UseCRISPRTags3xFLAGExpressionMammalianMutationD10A nickase-converting mutationPromoterCBhAvailable sinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA1-gltA2-udhA-zwf
Plasmid#87152PurposegltA1-gltA2-udhA-zwf targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA1-gltA2-udhA-zwf guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available sinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA1-gltA2-udhA-GapAP1
Plasmid#87151PurposegltA1-gltA2-udhA-GapAP1 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA1-gltA2-udhA-GapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available sinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-fabI-gltA1-gltA2-gapAP1
Plasmid#87147PurposefabI-gltA1-gltA2-gapAP1 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertfabI-gltA1-gltA2-gapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available sinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-NOG(AtUBI10)-MTAP-LUC
Plasmid#234371PurposeT-DNA vector for expression of the the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAs, no gRNA included (NOG)DepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis Ubi10 and MTAP1 (synthetic)Available sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEDJ-87
Plasmid#163085PurposeMarkerFree plasmid for integration of pADH1-MCP-VPR into site XI-5DepositorInsertVPR
TagsMCPExpressionYeastPromoterADH1Available sinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEDJ-22
Plasmid#140904PurposeMarkerFree plasmid for integration of pADH1-PCP-Mxi1 into site X-4DepositorInsertPCP-Mxi1
PromoterADH1Available sinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
S1_AscI_V5-gateway_Bsu36I
Plasmid#128467Purposedestination vector with N-terminal V5 tagDepositorInsertdestination vector with N-terminal V5 tag
ExpressionBacterialAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v4)-PGK-Puro-BFP
Plasmid#117143PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v4 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v5)-PGK-Puro-BFP
Plasmid#117144PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v5 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGB3omega1R Tnos:NptII:Pnos-SF (GB1181)
Plasmid#75471PurposeTranscriptional unit for kanamycin resistance geneDepositorInsertNptII
UseSynthetic BiologyExpressionPlantPromoterAgrobacterium tumefaciens Nopaline synthase promo…Available sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-frame_selector_2
Plasmid#127555PurposeDrosophila expression of frame selector sgRNA 2 that targets CRISPaint site for homology-independent knock-inDepositorInsertsgRNA frame 2
UseCRISPRExpressionInsectPromoterdU6:3Available sinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQ135A
Plasmid#69277PurposeGolden Gate entry vector; 5th gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141C
Plasmid#69292PurposeGateway entry vector; single gRNA under OsU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
JME4599
Plasmid#129660PurposeNATex_CrisprCas9-yl_RFP: CAS9 vector with Nourseothricin ex marker for gRNA cloning using GoldenGateDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by