pSuper.mBeta826
(Plasmid
#12549)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 12549 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSUPER-Retro
-
Backbone manufacturerOligoengine
- Backbone size w/o insert (bp) 4488
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA to mouse polymerase beta
-
SpeciesshRNA oligonucleotide
-
Insert Size (bp)65
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ccctttatccagccctcactc
- 3′ sequencing primer tttgcatgtcgctatgtgttc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
shRNA oligo sequence - 5'-gatcagtactactgtggtg
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSuper.mBeta826 was a gift from Robert Sobol (Addgene plasmid # 12549 ; http://n2t.net/addgene:12549 ; RRID:Addgene_12549) -
For your References section:
The role of base excision repair in the sensitivity and resistance to temozolomide-mediated cell death. Trivedi RN, Almeida KH, Fornsaglio JL, Schamus S, Sobol RW. Cancer Res. 2005 Jul 15. 65(14):6394-400. 10.1158/0008-5472.CAN-05-0715 PubMed 16024643