-
Plasmid#222125PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorInserteIF3D (EIF3D Human)
UseLentiviralTagsBFP-P2AExpressionMutationF527 truncationPromoterAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-a5helixDel-sgEIF3D
Plasmid#222133PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorInserteIF3D (EIF3D Human)
UseLentiviralTagsBFP-P2AExpressionMutationD249Q, V262I, Y263APromoterAvailable sinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-S528N-S529N-sgEIF3D
Plasmid#222129PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorInserteIF3D (EIF3D Human)
UseLentiviralTagsBFP-P2AExpressionMutationS528N, S529NPromoterAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
SaCas9v2-Puro
Plasmid#178802PurposeSaCas9 with 2A-Puro, and a cloning backbone for sgRNA.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHExpressionMutationPromoterEF1a and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mScarlet-H3C2
Plasmid#207781PurposeDonor template for mScarlet insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorArticleInsertH3C2 Homology Arms flanking a mScarlet Tag (H3C2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-C-mNeon-Blast-H3C2
Plasmid#207782PurposeDonor template for mNeon-2A-Blast insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorArticleInsertH3C2 Homology Arms flanking a mNeon-Blast Cassette (H3C2 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-sTagRFP-TUBA1B
Plasmid#207765PurposeDonor template for sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorArticleInsertTUBA1B Homology Arms flanking a sTagRFP Tag (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Blast-moxGFP-TUBA1B
Plasmid#207766PurposeDonor template for Blast-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorArticleInsertTUBA1B Homology Arms flanking a Blast-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-moxGFP-TUBA1B
Plasmid#207767PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorArticleInsertTUBA1B Homology Arms flanking a Puro-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-sTagRFP-TUBA1B
Plasmid#207769PurposeDonor template for Puro-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorArticleInsertTUBA1B Homology Arms flanking a Puro-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Sha3Cas9
Plasmid#192136PurposeExpresses Sha3Cas9, and cloning backbone for sgRNADepositorInsertSha3Cas9
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTij_sg_mmu_Med6_C_terminal
Plasmid#197869PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med6 C terminal and building MED6-mEmerald/Halo knock-in mESCsDepositorInsertMed6 (Med6 Mouse)
UseTagsExpressionMammalianMutationPromoterU6Available sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-Y-P2A-puro
Plasmid#192132PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-Y
UseAAVTagsExpressionMammalianMutationHsp1-Hsp2Cas9 (Y446A)PromoterAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hASCL1 gRNA_1-MS2-Puro
Plasmid#192670PurposeLentiviral expression of sgRNA targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNA #1 (ASCL1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL1RN gRNA_1-MS2-Puro
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-dora[B]_rescue_construct
Plasmid#190638PurposePuromycin-selectable expression of HA-tagged Dora[T295M] (CG34401) in Drosophila S2 cellsDepositorInsertDorado (CG34401 Fly)
UseTags3xHAExpressionInsectMutationChanged threonine 295 to methioninePromoterActin-5cAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-dora[A]_rescue_construct
Plasmid#190640PurposePuromycin-selectable expression of HA-tagged truncated Dora (CG34401) in Drosophila S2 cellsDepositorInsertDorado (CG34401 Fly)
UseTags3xHAExpressionInsectMutationTruncated to contain amino acids 1-945PromoterActin-5cAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-scrambled
Plasmid#183455PurposeThis control vector contains a scrambled version of the targeting sequence used in the pFUGW-shRIIα constructDepositorInsertscrambled sgRNA
UseLentiviralTagsExpressionMutationPromotershRNA: H1 / gene: ubiquitinAvailable sinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only