receives miRNA target sequences for testing using the dual luciferase assay system

Contains fusion of human Histone H2B to citrine.

For tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1

PCR-based C-terminal A1-FLAG tag

Bacterial expression for structure determination; may not be full ORF

Mammalian expression

3rd generation lentiviral gRNA plasmid targeting human HK2

Expression of the reporter gene under the control of the MiniPromoter in this plasmid has not been tested

Disruption of GLABROUS1 gene in Arabidopsis using CRISPR/Cas9

piggyBac vector to express an MLV Gag-EIF4E fusion protein

Ready-to-use AAV PHP.eB particles produced from AiP14496: pAAV-AiE0873m_3xC2-minBG-SYFP2-P2A-3XFLAG-10aa-H2B-WPRE3-BGHpA (Alias: CN4496) (#214858). In addition to the viral particles, you will also receive purified AiP14496: pAAV-AiE0873m_3xC2-minBG-SYFP2-P2A-3XFLAG-10aa-H2B-WPRE3-BGHpA (Alias: CN4496) plasmid DNA. minBG-driven expression of SYFP2 plus a separate nuclear FLAG epitope in striatal cholinergic neurons. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.

Co-expression of two genes in yeast with V5 and HA tags and HIS3 selection

Rep/Cap plasmid for the production of MyoAAV 4A, a muscle-tropic AAV capsid in mice and macaques.

Expression of HaloTags to outer surface in mammalian cells

In vivo visualization of actin cytoskeleton

Mammalian expression vector encoding GFP tagged human Timeless

Mammalian expression vector encoding GFP tagged human Tipin