We narrowed to 9,083 results for: sgRNA
-
Plasmid#249327PurposeExpresses sgRNA targeting the fcy gene in S. cerevisiaeDepositorInsertsgRNA targeting fcy
ExpressionYeastMutationN/AAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX462-ABE8e-nSaCas9
Plasmid#237462PurposeTransfection-based all-in-one base editor plasmid that expresses both adenine base editor (ABE8e-nSaCas9) and single guide RNAs (sgRNA) with BpiI cloning sites to clone sgRNA.DepositorInsert3xFlag_ABE8e_SaCas9 -6xNLS
UseCRISPRTags3xFLAGExpressionMammalianMutationD10APromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-2G-CNCB_sgRBBP6-68
Plasmid#237555PurposeA piggybac-based vector containing mouse U6 promoter-driven RBBP6 sgRNA #6, human U6 promoter-driven RBBP6 sgRNA #8 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorInsertRBBP6 (RBBP6 Human)
UsePiggybacExpressionMammalianPromotermouse U6 promoter and mouse U6 promoter, human U6…Available SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH020 sgControl (GEA)
Plasmid#228193PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH020 sgControl (ACOCB)
Plasmid#228194PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron3_sg3_pX458
Plasmid#127338PurposesgRNA that cuts within intron 3 of mouse CDK13 genomic locus- guide #3DepositorInsertMouse Cdk13 Intron 3 sgRNA
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron4_sg4_pX330
Plasmid#127341PurposesgRNA that cuts within intron 4 of mouse CDK13 genomic locus- guide #4DepositorInsertMouse Cdk13 Intron 4 Targeting sgRNA
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-4gRNA-GBX2-RFP
Plasmid#192288PurposeExpresses RFP and four sgRNAs against GBX2DepositorAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX335_U6-Chimeric_BB-CBh-hSpCas9n(D10A)_SOX17_Ex2_KI
Plasmid#195502PurposeCas9 nickase expression vector bearing a sgRNA targeting Exon 2 of human SOX17DepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_eSOX17.2_KO
Plasmid#195495PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the core endoderm distal enhancer of human SOX17DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgZmat3.52.6/Cre
Plasmid#167854PurposeExpresses Cre recombinase and an sgRNA targeting Zmat3DepositorInsertsgRNA targeting Zmat3
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
DDR1 gRNA (BRDN0001487115)
Plasmid#78009Purpose3rd generation lentiviral gRNA plasmid targeting human DDR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DDR1 gRNA (BRDN0001145659)
Plasmid#78010Purpose3rd generation lentiviral gRNA plasmid targeting human DDR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK2 gRNA (BRDN0001147665)
Plasmid#77909Purpose3rd generation lentiviral gRNA plasmid targeting human GK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK2 gRNA (BRDN0001145991)
Plasmid#77910Purpose3rd generation lentiviral gRNA plasmid targeting human GK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK2 gRNA (BRDN0001487045)
Plasmid#77911Purpose3rd generation lentiviral gRNA plasmid targeting human GK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AK9 gRNA (BRDN0001146911)
Plasmid#77689Purpose3rd generation lentiviral gRNA plasmid targeting human AK9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AK9 gRNA (BRDN0001162330)
Plasmid#77690Purpose3rd generation lentiviral gRNA plasmid targeting human AK9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AK9 gRNA (BRDN0001162237)
Plasmid#77691Purpose3rd generation lentiviral gRNA plasmid targeting human AK9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only