Ready-to-use AAV9 particles produced from pAAV-synapsin-HaloCaMP1a-EGFP (#138327). In addition to the viral particles, you will also receive purified pAAV-synapsin-HaloCaMP1a-EGFP plasmid DNA. Synapsin-driven HaloCaMP1a, a far-red calcium sensor, fused to EGFP. These AAV preparations are suitable purity for injection into animals.

Ready-to-use AAV1 particles produced from pAAV-synapsin-HaloCaMP1b-EGFP (#138328). In addition to the viral particles, you will also receive purified pAAV-synapsin-HaloCaMP1b-EGFP plasmid DNA. Synapsin-driven HaloCaMP1b, a far-red calcium sensor, fused to EGFP. These AAV preparations are suitable purity for injection into animals.

Ready-to-use AAV9 particles produced from pAAV-synapsin-HaloCaMP1b-EGFP (#138328). In addition to the viral particles, you will also receive purified pAAV-synapsin-HaloCaMP1b-EGFP plasmid DNA. Synapsin-driven HaloCaMP1b, a far-red calcium sensor, fused to EGFP. These AAV preparations are suitable purity for injection into animals.

mammalian expression of Sec23A tagged with HaloTag

RUSH cargo: Str-Ii_IRES_VSVG-SBP-Halo

mammalian expression of Sec31 tagged with HaloTag

Track mature and nascent FLAG tagged proteins in live cells

Protein expression vector with a TEV cleavable N-terminal 6xHis-MBP and a HRV 3C cleavable C-terminal HaloTag-StepTagII

AAVS1 safe harbor gene targeting donor expressing CAG-driven Nanoluc-HaloTag, compatible with pZT-AAVS1 TALENs

CLYBL safe harbor gene targeting donor expressing CAG-driven Nanoluc-HaloTag, compatible with pZT-C13 TALENs

To generate site specific attP-GA integrant cell lines upon co-delivery with BxbI. Contains T7-HaloTag-PDGFR_TM-T2A-Puro.

Targeting vector to introduce an Halotag cassette at the mouse Rad21 locus using NEOMYCINE selection. Designed for using with sgRNA CCACGGTTCCATATTATCTG

Donor vector to knock in Halotag C-terminal to human CRY1 gene

Donor vector to knock in Halotag C-terminal to human PER2 gene

Lentiviral expression vector encoding HaloTag-LC3 for monitoring autophagosome closure

mammalian expression of p58 (ie ERGIC-53; LMAN1) tagged with HaloTag

SapTrap HaloTag-GLO donor