173,913 results
-
Plasmid#239626PurposeRhamnose inducible expression plasmid for anti-mouse nanobody fusion to Hia5 DNA adenine methyltransferaseDepositorInsertHia5
Tags6HIS, MBP, TEV, and anti-Mouse NanobodyExpressionBacterialMutationCodon optimized for bacterial expressionPromoterrhaBADAvailable SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C2-NLRP3
Plasmid#73955PurposeExpress EGFP-tagged human NLRP3 in mammalian cellsDepositorInsertNLR family, pyrin domain containing 3 (NLRP3) (NLRP3 Human)
TagsEGFPExpressionMammalianPromoterCMV iEAvailable SinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (AAV5)
Viral Prep#100845-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (#100845). In addition to the viral particles, you will also receive purified pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 plasmid DNA. Syn-driven, Cre-dependent GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-MCN-10His-mStayGold (E138D)
Plasmid#211361PurposeBacterial expression of the bright and photostable monomeric StayGold fluorescent protein (E138D). Codon optimised for expression in Escherichia coli. Contains a N-terminal 10xHis tag.DepositorInsertmStayGold
Tags10xHis-tagExpressionBacterialMutationE138DPromoterT7Available SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJL1-mTagBFP2
Plasmid#102638PurposeIn vitro expression of mTagBFP2 from the T7 promoterDepositorInsertmTagBFP2
ExpressionBacterialPromoterT7Available SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_Lifeact_STf
Plasmid#182011PurposeCMV overexpression of SNAP-tag fast in mammalian cell lines associated to actinDepositorInsertLifeact_STf
ExpressionMammalianMutationFast mutation on SNAP-tag E30RPromoterCMVAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 BRGI-Flag
Plasmid#19143DepositorInsertSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (SMARCA4 Human)
TagsFlagExpressionMammalianAvailable SinceSept. 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MBP-ULK1-1-835-mcherry
Plasmid#249729PurposeExpressing human ULK1-1-835 with a MBP tag in N-terminal and a mcherry tag in C-terminalDepositorAvailable SinceMarch 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-GFP
Plasmid#171123PurposeDoxycycline inducible expression of GFPDepositorInsertEGFP
UseLentiviralExpressionMammalianPromoterTRE3GSAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2
Plasmid#52961PurposeReplaces original lentiCRISPRv1 (Addgene Plasmid 49535) and produces ~10-fold higher titer virus. 3rd generation lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS-NSAvailable SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry (AAV9)
Viral Prep#44361-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA. Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available SinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro
Plasmid#52963PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and puromycin resistance from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Puromycin resistance
UseCRISPR and LentiviralExpressionMammalianPromoterEf1-a and hU6Available SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV2/1
Plasmid#112862PurposeAAV packaging plasmid expressing Rep/Cap genesDepositorInsertRep2/Cap1
UseAAVPromoterTruncated P5Available SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE (AAV PHP.eB)
Viral Prep#104495-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE (#104495). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE plasmid DNA. CAG-driven, Cre-dependent GCaMP7s calcium sensor. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-GG-acceptor
Plasmid#132777PurposePrime editing in mammalian cellsDepositorInsertExchangeable cassette
ExpressionMammalianMutationSee manuscriptPromoterU6Available SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV2/9n
Plasmid#112865PurposeAAV packaging plasmid expressing Rep/Cap genesDepositorInsertRep2/Cap9
UseAAVPromoterTruncated P5Available SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-hTERT-IRES-hygro
Plasmid#85140PurposeLentiviral expression of hTERT, used to create immortalized cell linesDepositorAvailable SinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-Chimeric_BB-CBh-hSpCas9
Plasmid#42230PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid.DepositorArticleHas ServiceCloning Grade DNAInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBhAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only