169,450 results
-
Plasmid#36075DepositorAvailable SinceFeb. 7, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pCMV-MMLVgag-D3A-3L-dCas9-ZIM3
Plasmid#240531PurposeExpresses MMLVgag–DNMT3A-3L-dCas9-ZIM3 for producing RENDER-DNMT3A-3L-dCas9-ZIM3DepositorInsertMMLVgag-D3A-3L-dCas9-ZIM3
TagsFLAG, HAExpressionMammalianAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Brunello in lentiCRISPRv2 (Lentiviral Prep)
Viral Prep#73179-LVPurposeReady-to-use Lentiviral Prep particles produced from Human sgRNA library Brunello in lentiCRISPRv2 (#73179). In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiCRISPRv2 plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR screening in human cells. This backbone contains SpCas9 and unique gRNAs, and can be used to make edits across 19,114 genes in the human genome. In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiCRISPRv2.DepositorAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1
Plasmid#41393Purpose3rd generation, Inducible lentiviral expression, TRE-gateway; PGK-rtTA-2A-puroDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral; Gateway destination vector, doxycycli…ExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceNov. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
LsgRNA-MS2
Plasmid#235597PurposesgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. The cloning site is BsmbI.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
phMYT1L-N174
Plasmid#66809Purpose2nd generation lentiviral transfer plasmid. Expresses human MYT1L with G418 resistanceDepositorAvailable SinceSept. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Brunello in lentiCRISPRv2
Pooled Library#73179PurposeHuman sgRNA library in backbone lentiCRISPRv2 targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000 non-targeting controlsDepositorHas ServiceLentiviral PrepExpressionMammalianUseCRISPR and LentiviralAvailable SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSynapsin_psychLight2 (AAV9)
Viral Prep#163909-AAV9PurposeReady-to-use AAV9 particles produced from pAAV_hSynapsin_psychLight2 (#163909). In addition to the viral particles, you will also receive purified pAAV_hSynapsin_psychLight2 plasmid DNA. Synapsin-driven expression of the genetically encoded fluorescent sensor psychLight2 to detect behaviorally relevant serotonin release. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSIN-PAmCherry-KFERQ-NE
Plasmid#102365PurposeLentiviral overexpression of PA-mCherry-KFERQ fusionDepositorInsertsPA-mCherry
KFERQ peptide
UseLentiviralTagsNEExpressionMammalianPromoterEF-1aAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTargetF
Plasmid#62226PurposeConstitutive expression of sgRNA without donor editing template DNADepositorInsertsgRNA
UseCRISPRExpressionBacterialPromoterpij23119Available SinceMarch 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIRES-EGFP-puro
Plasmid#45567DepositorHas ServiceCloning Grade DNATypeEmpty backboneTagsIRES-EGFP-PuroExpressionMammalianPromoterPhcmv (strong human cytomegalovirus immediate ear…Available SinceJune 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD
Plasmid#98669PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43DepositorAvailable SinceJuly 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(mito).iATPSnFR2.A95A.A119L.HaloTag
Plasmid#209722PurposeExpresses mitochondrially targeted low affinity ratiometric ATP sensorDepositorInsert(mito).iATPSnFR2.A95A.A119L.HaloTag
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
6xHis-SNAP-PI(4)P Probe
Plasmid#211509PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-4-Phosphate (PI(4)P) from bacteriaDepositorInsertSidC (P4C)
Tags6xhis-SNAPExpressionBacterialAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCVneo-HA-ER-Hoxb8
Plasmid#222291PurposeThe most commonly used plasmid for the generation of ER-Hoxb8 conditionally immortalized myeloid cell lines.DepositorUseRetroviralTagsHAExpressionMammalianMutationThe estrogen receptor hormone binding domain cont…Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1179 U6-reci Gag-Cas9 v2
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKL2299A
Plasmid#222105PurposeA ternary vir helper plasmid that carries Agrobacterium tumefaciens virulence genes for enhanced plant genetic transformation.DepositorInsertvirA
ExpressionBacterial and PlantPromotervirA promoterAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
6xHis-SNAP-PI(3,5)P2 Probe
Plasmid#211512PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-3,5-Bisphosphate (PI(3,5)P2) from bacteriaDepositorInsertSnxA-2xPX
Tags6xhis-SNAPExpressionBacterialAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
phDLX1-N174
Plasmid#60859Purpose2nd generation lentiviral transfer plasmid. Expresses DLX1 under the EF1a promoterDepositorAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only