-
Plasmid#102597PurposeIFN-beta promoter driving luciferase. Use in IFN reporter assay.DepositorInsertHuman IFN-Beta promoter (IFNB1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-tdTomato (AAV PHP.eB)
Viral Prep#28306-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-FLEX-tdTomato (#28306). In addition to the viral particles, you will also receive purified pAAV-FLEX-tdTomato plasmid DNA. CAG-driven, Cre-dependent tdTomato expression control. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomato (Cre-dependent)Available sinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8f-WPRE (AAV9)
Viral Prep#162376-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-syn-jGCaMP8f-WPRE (#162376). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8f-WPRE plasmid DNA. Syn-driven expression of ultrafast calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
lenti-EF1a-dCas9-KRAB-Puro
Plasmid#99372Purpose3rd generation lenti vector encoding dCas9-KRAB with 2A puromycin resistance marker (EF1a-dCas9-KRAB-T2A-Puro-WPRE)DepositorInsertdCas9-KRAB-T2A-Puro
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon DREADD Gi-mCherry (AAV8)
Viral Prep#177672-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-Con/Fon DREADD Gi-mCherry (#177672). In addition to the viral particles, you will also receive purified pAAV-nEF-Con/Fon DREADD Gi-mCherry plasmid DNA. nEF-driven, Cre- and Flp-dependent hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsmCherryAvailable sinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2
Plasmid#75112Purposelenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2, dCas9-VP64, and blast resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 and EF1AAvailable sinceMay 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry (AAV9)
Viral Prep#44361-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA. Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available sinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV.CAP-B10
Plasmid#175004Purposenon-standard AAV2 rep-AAV.CAP-B10 cap plasmid with AAV cap expression controlled by a tTA-TRE amplifcation systemDepositorInsertSynthetic construct isolate AAV.CAP-B10 VP1 gene
UseAAVTagsExpressionMammalianMutation7 amino acid substitution between VP1 452 and VP1…Promoterp41Available sinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-EGFP (AAV1)
Viral Prep#50465-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA. hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFPAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAdDeltaF6
Plasmid#112867PurposeAAV helper plasmidDepositorInsertE4, E2a and VA
UseAAVTagsExpressionMutationPromoterAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 - TRC control
Plasmid#10879PurposeNegative control shRNA vector containing non-hairpin insert.DepositorInsertnon-hairpin 18bp
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.PI.EGFP.WPRE.bGH (AAV8)
Viral Prep#105530-AAV8PurposeReady-to-use AAV8 particles produced from pAAV.CMV.PI.EGFP.WPRE.bGH (#105530). In addition to the viral particles, you will also receive purified pAAV.CMV.PI.EGFP.WPRE.bGH plasmid DNA. CMV-driven EGFP control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCMVTagsEGFPAvailable sinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
BirA in pET28a (w400-2)
Plasmid#26624DepositorInsertBirA
UseTagsHisExpressionBacterialMutationPromoterAvailable sinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV2/8
Plasmid#112864PurposeAAV packaging plasmid expressing Rep/Cap genesDepositorInsertRep2/Cap8
UseAAVTagsExpressionMutationPromoterTruncated P5Available sinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] (AAV5)
Viral Prep#62723-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] (#62723). In addition to the viral particles, you will also receive purified pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] plasmid DNA. Cre-dependent ChrimsonR-tdTomato under the control of the Synapsin promoter. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagstdTomato (Cre-dependent)Available sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-hTERT-IRES-hygro
Plasmid#85140PurposeLentiviral expression of hTERT, used to create immortalized cell linesDepositorInserthTERT (TERT Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV.CamKII.GCaMP6s.WPRE.SV40 (AAV9)
Viral Prep#107790-AAV9PurposeReady-to-use AAV9 particles produced from AAV.CamKII.GCaMP6s.WPRE.SV40 (#107790). In addition to the viral particles, you will also receive purified AAV.CamKII.GCaMP6s.WPRE.SV40 plasmid DNA. CamKII-driven GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsNoneAvailable sinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO mCherry (AAV5)
Viral Prep#114471-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-Ef1a-fDIO mCherry (#114471). In addition to the viral particles, you will also receive purified pAAV-Ef1a-fDIO mCherry plasmid DNA. Ef1a-driven, Flp recombinase-dependent expression of mCherry. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Flp-dependent)Available sinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS-kI
Plasmid#51553PurposeMammalian phiC31 integrase expression vector. For use in applications where pseudosite integration is not desired.DepositorInsertphiC31 integrase
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2_mCherry_Grx1_roGFP2
Plasmid#155045PurposeFluorescent redox reporterDepositorInsertGlutaredoxin-1 (GLRX Human)
UseLentiviralTagsroGFP2ExpressionMammalianMutationPromoterCMVAvailable sinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2_mCherry_roGFP2_Orp1
Plasmid#155043PurposeFluorescent redox reporterDepositorInsertOrp1 (HYR1 Budding Yeast)
UseLentiviralTagsroGFP2ExpressionMammalianMutationPromoterCMVAvailable sinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-UGAcS
Plasmid#172135Purposemammalian expression plasmid for a UDP-GlcNAc sensorDepositorInsertUGAcS
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-hOCT3/4-shp53-F
Plasmid#27077PurposeIntegration-free (episomal) expression of human OCT3/4 and shRNA against p53DepositorInsertOCT3/4 (POU5F1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-mCherry (AAV9)
Viral Prep#50459-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-DIO-mCherry (#50459). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-mCherry plasmid DNA. hSyn-driven, Cre-dependent mCherry-expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available sinceApril 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDY1330 STITCHR pCMV-nCas9-XTEN-v170_R2Tocc
Plasmid#234826PurposeSTITCHR R2Tocc editorDepositorInsertnCas9h840a-xten-R2Tocc
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLCAR-CD19-BBz
Plasmid#135992PurposeModular 41BB-CD3z CAR backbone, For Transient Expression or Lentiviral ProductionDepositorUseLentiviralTagsExpressionMammalianMutationPromoterEF1a-shortAvailable sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.hSyn.Cre.WPRE.hGH (AAV Retrograde)
Viral Prep#105553-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pENN.AAV.hSyn.Cre.WPRE.hGH (#105553). In addition to the viral particles, you will also receive purified pENN.AAV.hSyn.Cre.WPRE.hGH plasmid DNA. hSyn-driven Cre expression. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCas9-Blast
Plasmid#52962PurposeExpresses human codon-optimized S. pyogenes Cas9 protein and blasticidin resistance from EFS promoter. 3rd generation lentiviral backbone.DepositorHas ServiceLentiviral PrepInsertsCas9
Blasticidin resistance
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationPromoterEFS-NSAvailable sinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-hUL
Plasmid#27080PurposeIntegration-free (episomal) expression of human L-MYC and LIN28DepositorUseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 10, 2011AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CamKII 0.4.Cre.SV40 (AAV Retrograde)
Viral Prep#105558-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pENN.AAV.CamKII 0.4.Cre.SV40 (#105558). In addition to the viral particles, you will also receive purified pENN.AAV.CamKII 0.4.Cre.SV40 plasmid DNA. CamKII-driven Cre expression. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsNoneAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Flpo (AAV1)
Viral Prep#55637-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-Flpo (#55637). In addition to the viral particles, you will also receive purified pAAV-EF1a-Flpo plasmid DNA. EF1a-driven Flpo recombinase expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsNoneAvailable sinceJuly 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV rtTA3 Hygro (w785-1)
Plasmid#26730Purpose3rd gen lentiviral reverse tetracycline-controlled transactivator 3 (rtTA3) expression vector, CMV promoter, HygroDepositorInsertTetracycline repressor A3 mutant
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCX420
Plasmid#229211PurposeCytoplasmic-targeting Csm complex plasmidDepositorArticleInsertCsm1; Csm2; Csm3(RNase mut)-2xsfGFP; Csm4; Csm5; Cas6
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO-sgRNA-puro
Plasmid#104321Purpose3rd generation lentiviral plasmid for inducible expression of sgRNA; derived from tet-pLKO-puro; puromycin selection. See manual for detailed protocols.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterH1/TOAvailable sinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCBASceI
Plasmid#26477PurposeI-SceI endonuclease expression vector with mammalian promoter to introduce a DSB at a genomic I-SceI siteDepositorInsertpCBASceI
UseTagsHAExpressionMammalianMutationPromoterAvailable sinceOct. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
Pepper-fused sgRNA
Plasmid#217520PurposeExpresses Pepper-fused sgRNA in mammalian cells with U6 promoterDepositorInsertPepper-fused sgRNA for spCas9
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-EGFP
Plasmid#19319Purpose3rd gen lentiviral vector for EGFP fusion; PGK driven puromycinDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianMutationPromoterAvailable sinceSept. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
eeBxb1
Plasmid#222339PurposePlasmid for expressing evolved and engineered Bxb1 in the mammalian cellsDepositorInsertCodon-optimized evolved and engineered Bxb1
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCBh_NLS_hfCas13X(Cas13X_M17YY)_NLS-pA-U6-DR-BpiI-BpiI-DR-pSV40-EGFP-pA-pSV40-mCherry-pA
Plasmid#190033Purposevector for encoding a human codon-optimized High-fidelity Cas13X (hfCas13X) driven by CBh promoter, guide RNAs compatible with Cas13X driven by hU6, EGFP and mCherry driven by SV40 promotersDepositorInserthumanized hfCas13X
UseTagsExpressionMammalianMutationY672A,Y676APromoterCBh, SV40, hU6Available sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only