173,812 results
-
Plasmid#107741PurposeExpresses superfolder GFP under the control of a blue-light transcriptional regulatorDepositorInsertsuperfolder GFP
ExpressionBacterialPromoterpLambdaAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry
Plasmid#44361PurposeDouble floxed Gq-coupled hM3D DREADD fused with mCherry under the control of human synapsin promoter.DepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserthM3D(Gq)-mCherry
UseAAV; Adeno associated viral vectorTagsmCherryPromoterhuman Synapsin 1Available SinceMay 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ADAM10-HA
Plasmid#65106PurposeExpression of HA tagged ADAM10 in mammalian cellsDepositorAvailable SinceOct. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
RHO3
Bacterial Strain#124700PurposeE. coli mobilizer strain that facilitates conjugation of mobilizable plasmids by using metabolic counter-selection against the donor strain.DepositorBacterial ResistanceDAP (400 µg/ml)Available SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLAG-KIF5A
Plasmid#166954PurposeExpresses FLAG-tagged KIF5A protein in pcDNA3.1DepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRY2PHR-mCherryN1
Plasmid#26866PurposeExpresses CRY2(1-498)-mCherry fusion for use in light-inducible protein interaction modulesDepositorAvailable SinceFeb. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMF230
Plasmid#62546PurposeBroad host range plasmid for constitutive expression of the eGFP. Developed for imaging Pseudomonas aeruginosa in biofilms.DepositorInsertGFP mut2
UseBroad host range plasmidPromotertrcAvailable SinceApril 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, Cancer and Apoptosis (h2), top 5 sgRNAs/gene
Pooled Library#83981PurposeHuman CRISPRa Pooled Library targeting cancer and apoptosis genesDepositorAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.PI.EGFP.WPRE.bGH
Plasmid#105530PurposeAAV expression of EGFP from CMV promoterDepositorHas ServiceAAV PHP.eB, AAV rh10, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEGFP
UseAAVExpressionMammalianPromoterCMVAvailable SinceFeb. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCW57-mCherry-2A-BRD4 Iso A
Plasmid#137720PurposeDoxycycline Inducible Expression of mCherry-2A-FLAG-BRD4 long isoformDepositorInsertBRD4 long isoform (BRD4 Human)
UseLentiviralTagsFLAGExpressionMammalianPromotertight TRE promoterAvailable SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAM234
Plasmid#226656PurposepcDNA3.1-p97-A232E-FLAGDepositorAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-EGFP-CNA35
Plasmid#61603Purposebacterial expression of N-terminal fusion protein of CNA35 with EGFPDepositorInsertEGFP and CNA35
TagsHis tagsExpressionBacterialPromoterT7Available SinceMarch 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
1GFP/RNase H1 D210N
Plasmid#174448PurposeExpress GFP-tagged RNase H1 D210N in E. coli.DepositorInsertRNase H1 (RNASEH1 Human)
TagsHis-tag, GFPExpressionBacterialMutationD210NPromoterT7 promoterAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
PH-PLCD1-GFP
Plasmid#51407PurposeIs a biosensor for PI(4,5)P2DepositorAvailable SinceMarch 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-GFP-LC3-RFP
Plasmid#84573PurposeExpresses GFP-LC3-RFP in mammalian cells to measure autophagic fluxDepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
UseRetroviralTagsEGFP and mRFP1ExpressionMammalianAvailable SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
PCDNA3-FlipGFP(Casp3 cleavage seq) T2A mCherry
Plasmid#124428PurposeExpresses FlipGFP (caspase-3 cleavage sequence) and T2A mCherry in mammalian cellsDepositorInsertFlipGFP(Casp3 cleavage seq) T2A mCherry
ExpressionMammalianAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCW57-mCherry-2A-BRD4 Iso C
Plasmid#137721PurposeDoxycycline Inducible Expression of mCherry-2A-FLAG-BRD4 short isoformDepositorInsertBRD4 short isoform (BRD4 Human)
UseLentiviralTagsFLAGExpressionMammalianPromoterTight TRE promoterAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NLS-GFP (AAV PHP.eB)
Viral Prep#104061-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-CAG-NLS-GFP (#104061). In addition to the viral particles, you will also receive purified pAAV-CAG-NLS-GFP plasmid DNA. CAG-driven NLS-GFP expression. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-STAT3
Plasmid#111934PurposeExpresses human STAT3 fused to GFP in mammalian cellsDepositorInsertSignal transducer and activator of transcription 3 (STAT3 Human)
TagsGFPExpressionMammalianPromoterCMVAvailable SinceJuly 19, 2018AvailabilityAcademic Institutions and Nonprofits only