Showing: 2281 - 2300 of 3246 results
-
Plasmid#220082PurposePA biosensor with tandem Spo20-PABDs and two NES domains to aid in nuclear exportDepositorInsertSpo20 (SPO20 Budding Yeast)
UseTagsX. leavis map2k1.L(32-44)-GGSG-X. leavis map2k1.L…ExpressionMammalianMutationamino acids 51-91, tandem dimerPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-DNA-PKcs
Plasmid#220493PurposeTo generate DNA-PKcs KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against DNA-PKcs exon 1.DepositorInsertsgRNA targeting DNA-PKcs (PRKDC) exon 1 (PRKDC Human)
UseCRISPRTagsExpressionMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-Lig4
Plasmid#220494PurposeTo generate LIG4 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against LIG4 exon 3.DepositorInsertsgRNA targeting LIG4 exon 3 (LIG4 Human)
UseCRISPRTagsExpressionMutationPromoterU6AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm1
Plasmid#222911PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 1 (NPM2 Human, Synthetic)
UseCRISPRTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm2
Plasmid#222912PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 2 (NPM2 Human, Synthetic)
UseCRISPRTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm3
Plasmid#222913PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 3 (NPM2 Human, Synthetic)
UseCRISPRTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm4
Plasmid#222914PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 4 (NPM2 Human, Synthetic)
UseCRISPRTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pHDR2_TFAP2C-T2A-mGreenLantern-Hygro
Plasmid#222915PurposeHomology directed repair template for knocking in mGreenLantern reporter to TFAP2C.DepositorInsertmGreenLantern
UseCRISPRTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
Antibody#213654-rAbPurposeAnti-Integrin αVβ8 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; binds the particular alpha/beta chain pair, does not block function.DepositorRecommended ApplicationsFlow CytometryReactivityHumanSource SpeciesRabbitIsotypeIgG1Trial SizeNot available to purchaseAvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#213655-rAbPurposeAnti-Integrin αVβ6 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; binds the particular alpha/beta chain pair, does not block function.DepositorRecommended ApplicationsFlow CytometryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgG1Trial SizeNot available to purchaseAvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#213656-rAbPurposeAnti-Integrin αVβ6 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; binds the particular alpha/beta chain pair, blocks ligand binding/function (RGD-mimetic)DepositorRecommended ApplicationsFlow CytometryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgG1Trial SizeNot available to purchaseAvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#213657-rAbPurposeAnti-Integrin αVβ6 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; binds the particular alpha/beta chain pair, blocks ligand binding/function (RGD-mimetic)DepositorRecommended ApplicationsFlow CytometryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgG1Trial SizeNot available to purchaseAvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#213658-rAbPurposeAnti-Integrin αVβ6 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; binds the particular alpha/beta chain pair, blocks ligand binding/function (RGD-mimetic)DepositorRecommended ApplicationsFlow CytometryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgG1Trial SizeNot available to purchaseAvailabilityIndustry, Academic Institutions, and Nonprofits
-
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pT7-7 aSyn C141
Plasmid#108866PurposeExpresses human WT alpha synuclein with a C-terminal cysteineDepositorInsertalpha synuclein (SNCA Human)
UseTagsExpressionBacterialMutationC141 mutation to allow C-terminal maleimide dye l…PromoterT7AvailabilityAcademic Institutions and Nonprofits only -
pCDFDuet-nsp7-nsp8
Plasmid#159092PurposeCoexpression construct of Nsp7 with an N-terminal His-tag and Nsp8DepositorInsertsNSP7
NSP8
UseTagsHisExpressionBacterialMutationPromoterT7AvailabilityAcademic Institutions and Nonprofits only -
pSBL_DK202
Plasmid#156426PurposeMammalian expression of 3a delta N(aa 42-275)-EGFP with CMV promoter, can be used for transfection or used to generate bacmids for baculoviral infection of mammalian cellsDepositorInsertSARS-CoV-2 3a protein (aa 42-275)
UseTagsEGFP-HisExpressionMammalianMutationaa 42-275PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-St1Cas9-sgRNA (KAC14)
Plasmid#133791PurposeU6 promoter sgRNA entry vector used for all St1Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to V1 sgRNA architecture from Carter et al. biorxiv 2018DepositorInsertSt1Cas9 sgRNA entry vector
UseTagsExpressionMammalianMutationV1 sgRNA architecture from Carter et al. biorxiv …PromoterU6AvailabilityAcademic Institutions and Nonprofits only -
lentiTet-OTX2-P2A-mCherry BlastR
Plasmid#186741PurposeDox inducible OTX2-P2A-mCherry expression construct cloned into a lentiviral backbone containing a blasticidin resistance geneDepositorInsertOTX2 (OTX2 Human)
UseLentiviralTagsP2A-mCherryExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
p2T CAG dCas9-10XGcn4-P2A-mCherry BlastR
Plasmid#186745PurposedCas9-10XGcn4-P2A-mCherry expression constructDepositorInsertCas9-10XGcn4-P2A-mCherry
UseCRISPRTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only
Showing: 2281 - 2300 of 3246 results