-
Plasmid#113394PurposeMET25p-MS2-RFP-CYC1 TTDepositorInsertMS2 bacteriophage coat protein
UseTagsred fluorescent protein (RFP), codon-optimized fo…ExpressionYeastMutationPromoterAvailable sinceAug. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1137
Plasmid#84827PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and synthetic intronsDepositorInsertC. elegans codon optimized GFP
UseTagsExpressionBacterial and WormMutationPromoterPeft-3Available sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
miCBE
Plasmid#205413PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with APOBEC3A and UGI driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpU6__RNA*_pCAG_bpNLS_APOBEC3A(W104A)_XTEN_OgeuIscB*(D61A)_NLS_2xUGI_bGHployA_pCMV_mCherry
UseTagsExpressionMammalianMutationD61A+E85R+H369R+S387R+S457RPromoterhU6, CAG, CMVAvailable sinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC-tdTomato
Plasmid#62516PurposeExpresses tdTomato under the UbC promoter. This promoter expresses transgenes in neurons at higher levels than plasmids with the CMV. Optimal for tracing axons in tissue clearing proceduresDepositorInserttdTomato
UseAAV and Synthetic BiologyTagsExpressionMammalianMutationPromoterhUbCAvailable sinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1955
Plasmid#84830PurposeMinimos transposon with Peft-3:tdTomato:tbb-2 3'UTR and cbr-unc-119 selection. tdTomato was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and synthetic intronsDepositorInsertC. elegans codon optimized tdTomato
UseTagsExpressionBacterial and WormMutationPromoterPeft-3Available sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1415
Plasmid#84828PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-1 intronsDepositorInsertC. elegans codon optimized GFP
UseTagsExpressionBacterial and WormMutationPromoterPeft-3Available sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1320
Plasmid#84829PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-2 intronsDepositorInsertC. elegans codon optimized GFP
UseTagsExpressionBacterial and WormMutationPromoterPeft-3Available sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-SpCas9-NRTH-P2A-EGFP (RMD63)
Plasmid#197500PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRTH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRTH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRTH(D10A/I…PromoterCMV and T7Available sinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-HOIL-1 full-length (1–510)
Plasmid#193858PurposeExpression of human His-tagged HOIL-1 (RBCK1) full-length (1–510) codon optimized for E. coliDepositorInsertHOIL-1 (RBCK1 Human)
UseTags3C protease cleavage site and 6x-His tagExpressionBacterialMutationCodon optimised for expression in E. coliPromoterT7Available sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q
Plasmid#184249PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertAtaxin-3 full length with 3 UIMs and 77Q in the Poly-Q track (ATXN3 Synthetic, Human)
UseTags6x His-Tag and TEV cleavage siteExpressionBacterialMutationCodon optimization for protein expression in BL2…PromoterT7 promoterAvailable sinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q-R388G
Plasmid#184251PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track-R388G fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track and point mutation R388G (ATXN3 Synthetic, Human)
UseTags6x His-Tag and TEV cleavage siteExpressionBacterialMutationC-terminal codon optimization for protein expres…PromoterT7 promoterAvailable sinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZE21/UBP1/ClpS_V65I
Plasmid#98567PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and the V65I engineered variant of E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
Mutated ATP-dependent Clp protease adapter protein
UseTagsExpressionBacterialMutationContains the V65I mutation that increases discrim…PromoterAvailable sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBad-sfGFP
Plasmid#85482PurposeArabinose inducible E. coli codon optimized superfolder GFP with C-terminal His6 tagDepositorInsertsuperfolder GFP
UseTags6x HisExpressionBacterialMutationPromoterArabinoseAvailable sinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRBC-sfGFP wild type
Plasmid#174075PurposePlasmid with p15a origin of replication expressing codon optimized superfolder GFP with C-terminal His6 tag, under T7 promoterDepositorInsertSuperfolder GFP
UseTagsHis-6ExpressionBacterialMutationPromoterT7Available sinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRBC-sfGFP-150TAG
Plasmid#174076PurposePlasmid with p15a origin of replication expressing codon optimized superfolder GFP-150 TAG with C-terminal His6 tag, under T7 promoter,DepositorInsertSuperfolder GFP
UseTagsHis-6ExpressionBacterialMutationN150TAGPromoterT7Available sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCas9-Blast
Plasmid#52962PurposeExpresses human codon-optimized S. pyogenes Cas9 protein and blasticidin resistance from EFS promoter. 3rd generation lentiviral backbone.DepositorHas ServiceLentiviral PrepInsertsCas9
Blasticidin resistance
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationPromoterEFS-NSAvailable sinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-PE-bacteria
Plasmid#172715PurposeExpression of an E. coli codon optimized fusion protein of Cas9n-linker-M-MLV2 for prime editingDepositorInsertCas9n-linker-M-MLV2
UseTagsExpressionBacterialMutationH840A of Cas9PromoterAvailable sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only