Skip to main content
Addgene

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
172574 pDONR/zeo-TARG1 TARG1 (Homo sapiens) Feijs Apr 07, 2022
182929 CRISPR-psbA2 point mutation ddcpf1 (Other), gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc, psbA (Other) Pakrasi Apr 07, 2022
180082-rAb.T Anti-PSD-95 [K28/43R] (Recombinant Antibody trial size) Trimmer Apr 07, 2022
180084-rAb.T Anti-GFP [N86/38.1R] (Recombinant Antibody trial size) Trimmer Apr 07, 2022
182579 mCherry-Cytb5 mCherry-Cytb5 Manor Apr 06, 2022
181916 pLenti-CMV-NGLY1-Puro N-glycanase 1 (Homo sapiens) Dixon Apr 06, 2022
182580 mCherry-Fis1 mCherry-Fis1 Manor Apr 06, 2022
181918 pTwist-SFFV-NFE2L18ND-Puro NFE2L1 (Homo sapiens) Dixon Apr 06, 2022
181917 pTwist-SFFV-NFE2L1-Puro NFE2L1 (Homo sapiens) Dixon Apr 06, 2022
181741 pAAV-EF1α-DIO-SN SuperNova (monomeric photosensitizing fluorescent protein for chromophore-assisted light inactivation) (Synthetic) Hayashi Apr 06, 2022
181742 pAAV-CAG-DIO-CFL-SN-P2A-GCaMP6f CFL-SN-P2A-GCaMP6f (Homo sapiens) Hayashi Apr 06, 2022
181740 pAAV-EF1α-DIO-CFL-SN CFL-SN (Homo sapiens) Hayashi Apr 06, 2022
182706 pNL3.1-Erg Enhancer of Erythroblast transformation-specific-Related Gene (Mus musculus) Rowe Apr 06, 2022
176547 pH-mRuby2 yomRuby2 (Synthetic) Ralser Apr 06, 2022
176552 pL-mWasabi mWasabi (Synthetic) Ralser Apr 06, 2022
176555 pH-eCFP eCFP (Synthetic) Ralser Apr 06, 2022
176556 pL-eCFP eCFP (Synthetic) Ralser Apr 06, 2022
176557 pU-eCFP eCFP (Synthetic) Ralser Apr 06, 2022
176558 pM-eCFP eCFP (Synthetic) Ralser Apr 06, 2022
176560 pH-TagRFP657 TagRFP657 (Synthetic) Ralser Apr 06, 2022
176563 pM-TagRFP657 TagRFP657 (Synthetic) Ralser Apr 06, 2022
182539 pDY0973-RADARS iCaspase iCaspase9 (Homo sapiens) Abudayyeh Apr 06, 2022
182540 pDY1243-Fluorescent RADARS mNeon Abudayyeh Apr 06, 2022
182538 pDY0551-Luciferase RADARS RADARS Luciferase Abudayyeh Apr 06, 2022
182928 pRha-rsw-EYFP EYFP Pakrasi Apr 06, 2022
182927 pCRISPRi-D2 ddcpf1 (Synthetic) Pakrasi Apr 06, 2022
183097 pH-ePPE Nls-nCas9-NC-nls-MLV-Nls (Synthetic) Gao Apr 06, 2022
183096 ePPE-spG Nls-nspGCas9-NC-nls-MLV-Nls (Synthetic) Gao Apr 06, 2022
183095 ePPE Nls-nCas9-NC-nls-MLV-Nls (Synthetic) Gao Apr 06, 2022
182205 3xTRE DREaMR 3p3GFP rTetR-3XP3-GFP Montell Apr 05, 2022
182207 DmU6 3p3 GFP LgRNA 3XP3-GFP Montell Apr 05, 2022
182203 1xTRE DREaMR 3p3GFP rTetR-3XP3-GFP Montell Apr 05, 2022
182206 3xTRE DREaMR 3p3DsR rTetR-3XP3-DsRed Montell Apr 05, 2022
182204 1xTRE DREaMR 3p3DsR rTetR-3XP3-DsRed Montell Apr 05, 2022
178596 pWP001 CBD-SmBiT/LgBiT (Other) Fagan Apr 05, 2022
178601 pJAK175 Bitlucopt (Synthetic) Fagan Apr 05, 2022
182276 6xHis-MBP-BrCas12b BrCas12b (Other) Jain Apr 05, 2022
177763 PX459_GRHL1-exon5 GRHL1 (Homo sapiens) Ristow Apr 05, 2022
177764 PX459_GRHL1-exon8 GRHL1 (Homo sapiens) Ristow Apr 05, 2022
177765 pcDNA3.1_Hygro(+)_GRHL1-L3F6H GRHL1 (Homo sapiens) Ristow Apr 05, 2022
177767 pcDNA3.1_Hygro(+)_GRHL1-R9A-L3F6H GRHL1 (Homo sapiens) Ristow Apr 05, 2022
177768 pcDNA3.1_Hygro(+)_GRHL1-S95A-L3F6H GRHL1 (Homo sapiens) Ristow Apr 05, 2022
177769 pcDNA3.1_Hygro(+)_GRHL1-K116A-L3F6H GRHL1 (Homo sapiens) Ristow Apr 05, 2022
177770 pcDNA3.1_Hygro(+)_GRHL1-T139A-L3F6H GRHL1 (Homo sapiens) Ristow Apr 05, 2022
177771 pcDNA3.1_Hygro(+)_GRHL1-K370A-L3F6H GRHL1 (Homo sapiens) Ristow Apr 05, 2022
177772 pcDNA3.1_Hygro(+)_GRHL1-S374A-L3F6H GRHL1 (Homo sapiens) Ristow Apr 05, 2022
177773 pcDNA3.1_Hygro(+)_GRHL1-K592A-L3F6H GRHL1 (Homo sapiens) Ristow Apr 05, 2022
177774 pGL4.27_GRHL-SPE GRHL (Homo sapiens) Ristow Apr 05, 2022
177775 pGL4.27_ARE/NRF2-SPE NRF2 (Homo sapiens) Ristow Apr 05, 2022
177761 pdestMB14_grh-1p-grh-1-gfp grh-1 (Caenorhabditis elegans) Ristow Apr 05, 2022