|
|
195570 |
pTet-Bxb1-Xis-mScarlet |
Bxb1 Excisionase Fused With mScarlet (Synthetic)
|
Murray |
Aug 04, 2023 |
|
|
202070 |
pGEX-2T_E30_VP1 |
E30 VP1 protein with Histag (Synthetic)
|
Hytönen |
Aug 04, 2023 |
|
|
204720 |
iD20 LoxStopLox-Zim3-dCas9-mApple-hygro |
Zim3-dCas9 (Synthetic)
|
Ward |
Aug 04, 2023 |
|
|
201917 |
pJRH-1346 U6-B2M sgRNA Gag-pol v2 |
Gag-pol, B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
|
Doudna |
Aug 04, 2023 |
|
|
201913 |
pJRH-1187 VSVGmut |
VSV-G (K47Q, R354A) (Other)
|
Doudna |
Aug 04, 2023 |
|
|
201914 |
pJRH-1179 U6-reci Gag-Cas9 v2 |
Gag-Cas9 v2
|
Doudna |
Aug 04, 2023 |
|
|
204719 |
iC10 PB-zim3-mycNLS-mApple-hygro |
Zim3-dCas9 (Synthetic)
|
Ward |
Aug 04, 2023 |
|
|
201915 |
pJRH-1180 U6-reci Gag-pol v2 |
Gag-pol
|
Doudna |
Aug 04, 2023 |
|
|
201912 |
pJRH-1362 scFv entry plasmid |
Stuffer sequence (drop out for scFv cloning) + CD8 hinge and transmembrane domain
|
Doudna |
Aug 04, 2023 |
|
|
204718 |
iB22 PB-zim3-mycNLS-mApple |
Zim3-dCas9 (Synthetic)
|
Ward |
Aug 04, 2023 |
|
|
201916 |
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2 |
Gag-Cas9 v2, B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
|
Doudna |
Aug 04, 2023 |
|
|
198948 |
pGL0_35 [aadA] |
aadA (Other)
|
Ostrov |
Aug 04, 2023 |
|
|
198975 |
pGL0_64 [mScarlet] |
mScarlet-I (Synthetic)
|
Ostrov |
Aug 04, 2023 |
|
|
202069 |
pGEX-2T_CVB1_VP1 |
CVB1 VP1 protein with Histag (Synthetic)
|
Hytönen |
Aug 04, 2023 |
|
|
202068 |
pGEX-2T_CVA4_VP1 |
CVA4 VP1 protein with Histag (Synthetic)
|
Hytönen |
Aug 04, 2023 |
|
|
199120 |
pDT4 |
synthetic transcription template
|
Gelles |
Aug 04, 2023 |
|
|
199119 |
pDT2 |
lambda PR' - repeat cassette - E. coli rpoB - lambda TR' (Synthetic)
|
Gelles |
Aug 04, 2023 |
|
|
199118 |
pKI1 |
H6-SNAP-RapA (Other)
|
Gelles |
Aug 04, 2023 |
|
|
195580 |
pAAV_hSynapsin1_NOPLight1 |
NOPLight1 (Homo sapiens)
|
Patriarchi |
Aug 04, 2023 |
|
|
195579 |
pCMV_NOPLight-ctr |
NOPLight-ctr (Homo sapiens)
|
Patriarchi |
Aug 04, 2023 |
|
|
195578 |
pCMV_NOPlight1 |
NOPLight1 (Homo sapiens)
|
Patriarchi |
Aug 04, 2023 |
|
|
199149 |
RB821 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199148 |
RB820 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199147 |
RB819 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199145 |
RB817 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199144 |
RB816 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199143 |
RB815 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199142 |
RB814 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199141 |
RB813 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199140 |
RB812 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199139 |
RB811 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199138 |
RB810 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199137 |
RB809 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199136 |
RB808 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199135 |
RB807 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199134 |
RB806 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199133 |
RB805 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199132 |
RB804 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199131 |
RB803 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199130 |
RB802 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199129 |
RB801 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199128 |
RB800 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199127 |
RB799 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199126 |
RB798 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199125 |
RB797 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199124 |
RB796 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199123 |
RB795 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199122 |
RB794 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199121 |
RB793 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
201190 |
pRha-ABE8e-SpCas9-NG |
ABE8e-SpCas9-NG (Synthetic)
|
Yen |
Aug 04, 2023 |
