Skip to main content
Addgene

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
190223 pSBbi-NLSmCherryNLS Clover-HDHB Human DNA Helicase B (amino acids 994-1087) (Homo sapiens), NLS-mCherry-NLS-P2A-Puromycin Heiser Sep 12, 2022
184680 pNIR-Fb6m NIR-Fb6m (Synthetic) Verkhusha Sep 09, 2022
187703 pLenti-Hsp25 S15A Hsp25 (Mus musculus) Beckerle Sep 09, 2022
184686 pmiRFP670nano3-NbGFP miRFP670nano3-NbGFP (Synthetic) Verkhusha Sep 09, 2022
187695 pLenti-Zyxin-C (aa139-371)-EGFP Zyxin (Mus musculus) Beckerle Sep 09, 2022
187693 pLenti-Zyxin-A (aa139-564)-EGFP Zyxin (Mus musculus) Beckerle Sep 09, 2022
189974 HBA1 full 3'UTR-T4 td downstream intron HBA1 full 3'UTR-T4 td downstream intron Chang Sep 09, 2022
189969 HRV-B3 IRES HRV-B3 IRES Chang Sep 09, 2022
189975 3xFLAG-NanoLuc NanoLuc (Synthetic) Chang Sep 09, 2022
189968 CVB3 IRES CVB3 IRES Chang Sep 09, 2022
187696 pLenti-Zyxin-D (aa160-340)-EGFP Zyxin (Mus musculus) Beckerle Sep 09, 2022
187694 pLenti-Zyxin-B (aa309-564)-EGFP Zyxin (Mus musculus) Beckerle Sep 09, 2022
188540 phABCA3-eGFP_CRISPR_Donor EGFP Kotton Sep 09, 2022
188390 NLS-CanlonicSF NLS-CanlonicSF (Synthetic) San Martín Sep 09, 2022
187683 pCMV-SUN1 mScarlet SUN1 (Mus musculus) Beckerle Sep 09, 2022
190068 pCAG-CalfluxCTN CalfluxCTN (Synthetic) Johnson Sep 09, 2022
190265 pPROEX-TwStrp-FTO FTO (Homo sapiens) Jaffrey Sep 09, 2022
187681 pCMV-Pom121 mScarlet Pom121 (Mus musculus) Beckerle Sep 09, 2022
187685 pCMV-SUN2 mScarlet SUN2 (Mus musculus) Beckerle Sep 09, 2022
190041 pC3.1-caggs-Crimson-CAAX Crimson (Other) Lin Sep 09, 2022
188968 pT-GFP-rG2 GFP (Synthetic), sgRNA: agtccatgtaatcagcgtctactagt Lee Sep 09, 2022
179485 pSF11-wmiRFP2-T2A-HO1 wmIRFP2-T2A-HO1 (Homo sapiens) Piatkevich Sep 09, 2022
178972 pKeratin-emiRFP2-N1 Keratin-emiRFP2 (Homo sapiens) Piatkevich Sep 09, 2022
187690 pE-mApple L5L2 mApple (Other) Beckerle Sep 09, 2022
187675 pcDNA-SUN1 EGFP SUN1 (Mus musculus) Beckerle Sep 09, 2022
173812 pITGA5_1745G>U NT1745 ITGA5 point mutation (Homo sapiens) Siedlecki Sep 09, 2022
173811 pITGA5_473G>A NT473 ITGA5 point mutation (Homo sapiens) Siedlecki Sep 09, 2022
187678 pcDNA-SUN2 EGFP SUN2 (Mus musculus) Beckerle Sep 09, 2022
187684 pCMV-SUN2 GFP SUN2 (Mus musculus) Beckerle Sep 09, 2022
187912 pSAC212 ade2 KO CRISPEY cassette (Synthetic) Fraser Sep 09, 2022
187677 pcDNA-SUN1 mScarlet SUN1 (Mus musculus) Beckerle Sep 09, 2022
189957 pLKO.1-Tet-Puro-shMMERVK9c_1 (inducible) ERV_MMERVK9c (Mus musculus) Hnisz Sep 09, 2022
189956 pLKO.1-Tet-Puro-shMMERVK10c_2 (inducible) ERV_MMERVK10c (Mus musculus) Hnisz Sep 09, 2022
189954 pLKO.1-Tet-Puro-shMMETn_2 (inducible) ERV_MMETn (Mus musculus) Hnisz Sep 09, 2022
189953 pLKO.1-Tet-Puro-shMMETn_1 (inducible) ERV_MMETn (Mus musculus) Hnisz Sep 09, 2022
189958 pLKO.1-Tet-Puro-shMMERVK9c_2 (inducible) ERV_MMERVK9c (Mus musculus) Hnisz Sep 09, 2022
189955 pLKO.1-Tet-Puro-shMMERVK10c_1 (inducible) ERV_MMERVK10c (Mus musculus) Hnisz Sep 09, 2022
178342 CanlonicSF CanlonicSF (Synthetic) San Martín Sep 09, 2022
178343 ER-CanlonicSF ER-CanlonicSF (Synthetic) San Martín Sep 09, 2022
187680 pCMV-Pom121 GFP Pom121 (Mus musculus) Beckerle Sep 09, 2022
184247 ATX3-JD Ataxin-3 Josephin domain (Homo sapiens) Macedo Ribeiro Sep 09, 2022
184246 ATX3-D1 Ataxin-3 Josephin domain and UIM1 (Homo sapiens) Macedo Ribeiro Sep 09, 2022
187676 pcDNA-SUN1 mApple SUN1 (Mus musculus) Beckerle Sep 09, 2022
186691 pBFC0625 tnsA (Other), tnsB (Other), tnsC (Other), tnsD (Other), tniQ (Other), cas8-cas5 fusion (Other), cas7 (Other), cas6 (Other), Vc_lacZ_α_1 Spacer crRNA (Other), Tn7 transposon (Other), GmR+sfGFP VcDART Cargo Doudna Sep 09, 2022
186694 pBFC1207 tnsA (Other), tnsB (Other), tnsC (Other), tnsD (Other), tniQ (Other), cas8-cas5 fusion (Other), cas7 (Other), cas6 (Other), Vc_2xBsaI_NT (Guide Stuffer) crRNA (Other), Tn7 transposon (Other), GmR+sfGFP VcDART Cargo, SbfI+AsiSI dual restriction site for donor plasmid removal during ET-Seq Doudna Sep 09, 2022
174505 Pxyl-ftsZ-sfGFP ftsZ (Other) Manley Sep 09, 2022
174506 pMT335-mScarletI mScarletI (Other) Manley Sep 09, 2022
186692 pBFC0687 tnsB (Other), tnsC (Other), tniQ (Other), Cas12k (Other), Sh_2xBsaI_NT (Guide Stuffer) gRNA (Other), Tn7 transposon (Other), GmR+sfGFP ShDART Cargo Doudna Sep 09, 2022
186693 pBFC0694 tnsB (Other), tnsC (Other), tniQ (Other), Cas12k (Other), Sh_lacZ_α_1 gRNA (Other), Tn7 transposon (Other), GmR+sfGFP ShDART Cargo Doudna Sep 09, 2022
186695 pBFC0996 tnsA (Other), tnsB (Other), tnsC (Other), tnsD (Other), tniQ (Other), cas8-cas5 fusion (Other), cas7 (Other), cas6 (Other), crRNA (Other), Tn7 transposon (Other), 2xLguI Cargo Stuffer, SbfI+AsiSI dual restriction site for donor plasmid removal during ET-Seq Doudna Sep 09, 2022