pX330-HA-dSpCas9
(Plasmid #92112)

• Purpose: Expression plasmid for human codon-optimized dead/inactive SpCas9 (without U6-sgRNA coding sequence)
• Depositing Lab: Ervin Welker
• Publication: Kulcsar et al Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8.

Backbone

• Vector backbone: pX330-like (without U6-sgRNA coding sequence)
• Total vector size (bp): 8017
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dead/inactive SpCas9
• Alt name: dSpCas9
• Species: S. pyogenes
• Insert Size (bp): 4215
• Mutation: D10A, H840A
• Promoter: Cbh
• Tags / Fusion Proteins:
  • HA tag (N terminal on insert)
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GACTCAAGACGATAGTTACC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Alternate plasmid name: pCbh-HA-NLS-dSpCas9-NLS (no U6-sgRNA coding sequence)

For detailed information and plasmid usage, please see the associated publication.