pTUB1:YFP-AID-3HA, DHFR-TS:HXGPRT
(Plasmid #87260)

• Purpose: YFP-AID-3HA fusion driven by a minimal TUB1 promoter with an HXGPRT drug selectable marker. The AID CDS is Arabidopsis thaliana auxin-responsive protein IAA17.
• Depositing Lab: David Sibley
• Publication: Brown et al MBio. 2017 May 2;8(3). pii: e00375-17. doi: 10.1128/mBio.00375-17.

Backbone

• Vector backbone: pBluescript SK(+)
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 2925
• Total vector size (bp): 9655
• Vector type: Toxoplasma expression
• Selectable markers: HXGPRT

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: YFP-AID-3HA
• Species: Synthetic
• Insert Size (bp): 1569
• GenBank ID: 4335696
• Promoter: TgTUB1 378 bp
• Tags / Fusion Proteins:
  • AID (C terminal on insert)
  • 3HA (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: M13 Rev caggaaacagctatgac
• 3′ sequencing primer: ggcattatacccgtgtgttacg

Gene/Insert 2

• Gene/Insert name: HXGPRT
• Species: T. gondii
• Insert Size (bp): 693
• Promoter: TgDHFR-TS 463 bp

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: gagacgcgtgtctcgtagaa
• 3′ sequencing primer: aaacgagagacgggcagctt

Resource Information

• Supplemental Documents:
  • Annotated GenBank file
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry