-
PurposeTIR1-3FLAG fusion driven by a TUB1 promoter with a CAT drug selectable marker. The TIR1 CDS from Oryza sativa was codon optimized for T. gondii expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87258 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBluescript SK(+)
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 2925
- Total vector size (bp) 9655
-
Vector typeToxoplasma expression
-
Selectable markersCAT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTIR1
-
SpeciesSynthetic; Oryza sativa
-
Insert Size (bp)1806
-
MutationCodon optimized for Toxoplasma gondii expression
-
GenBank ID4335696
- Promoter TgTUB1 2717 bp
-
Tag
/ Fusion Protein
- 3FLAG (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer cttgtgtgaagttcttgcgg
- 3′ sequencing primer gataaaggacacaggggtct (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCAT
-
Alt nameChloramphenicol acetyltransferase
-
Alt nameCmR
-
SpeciesSynthetic
-
Insert Size (bp)663
- Promoter TgSAG1 361 bp
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer cggttgtatgtcggtttcgc
- 3′ sequencing primer tgtgtattgacccatgtggc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTUB1:OsTIR1-3FLAG, SAG1:CAT was a gift from David Sibley (Addgene plasmid # 87258 ; http://n2t.net/addgene:87258 ; RRID:Addgene_87258) -
For your References section:
Plasma Membrane Association by N-Acylation Governs PKG Function in Toxoplasma gondii. Brown KM, Long S, Sibley LD. MBio. 2017 May 2;8(3). pii: e00375-17. doi: 10.1128/mBio.00375-17. 10.1128/mBio.00375-17 PubMed 28465425