pRL25
(Plasmid
#70253)
-
Purpose(Empty Backbone) Shuttle vector suitable for transfer to Anabaena (Nostoc) sp. strain PCC 7120 and other cyanobacterial strains
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70253 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneDerivative of pBR322 and pDU1
- Backbone size (bp) 9841
-
Vector typeBacterial shuttle vector
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer pBR322ori-3 tttgtttgcaagcagcagat (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypDU1 was derived from Nostoc sp. strain PCC 7524; pBR322 was openly available
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Multiple references:
(i) Wolk CP, Vonshak A, Kehoe P, Elhai J (1984) Construction of shuttle vectors capable of conjugative transfer from Escherichia coli to nitrogen-fixing filamentous cyanobacteria. Proc Natl Acad Sci USA 81: 1561-1565
(ii) Schmetterer G, Wolk CP (1988) Identification of the region of cyanobacterial plasmid pDU1 necessary for replication in Anabaena sp strain M-131. Gene 62: 101-109
(iii) Wolk CP, Cai Y, Cardemil L, Flores E, Hohn B, Murry M, Schmetterer G, Schrautemeier B, Wilson R (1988) Isolation and complementation of mutants of Anabaena sp. strain PCC 7120 unable to grow aerobically on dinitrogen. J Bacteriol 170: 1239-1244
Wolk CP, Fan Q, Zhou R, Huang G, Lechno-Yossef S, Kuritz T, Wojciuch E (2007) Paired cloning vectors for complementation of mutations in the cyanobacterium Anabaena sp. strain PCC 7120. Arch Microbiol 188: 551-563
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRL25 was a gift from Peter Wolk (Addgene plasmid # 70253 ; http://n2t.net/addgene:70253 ; RRID:Addgene_70253) -
For your References section:
Isolation and complementation of mutants of Anabaena sp. strain PCC 7120 unable to grow aerobically on dinitrogen. Wolk CP, Cai Y, Cardemil L, Flores E, Hohn B, Murry M, Schmetterer G, Schrautemeier B, Wilson R. J Bacteriol. 1988 Mar;170(3):1239-44. PubMed 2830231