pT2-7xTcf-NLS-ONL-CP
(Plasmid
#65716)
-
PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-ONL-CP)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65716 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBluescript II SK(+) based Tol2 donor vector
-
Backbone manufacturerAgilent Biotechnology, National Institute of Genetics (Dr Koichi Kawakami Lab)
- Backbone size w/o insert (bp) 7700
- Total vector size (bp) 9900
-
Vector typeLuciferase
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name7xTcf, minCMV, 3xNLS, ONL, hCL1-PEST
-
Alt name7xTcf-NLS-ONL-CP
-
SpeciesSynthetic
-
Insert Size (bp)2200
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGATGGGGCTCTAGGAATAAAATATC
- 3′ sequencing primer GCTCCAGACTGCCTTGGGAAAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhmKusabiraOrange2 (gifted from Dr Atsushi Miyawaki), Tol2 system (gifted from Dr Koichi Kawakami)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT2-7xTcf-NLS-ONL-CP was a gift from Yasushi Okada (Addgene plasmid # 65716 ; http://n2t.net/addgene:65716 ; RRID:Addgene_65716) -
For your References section:
Expanded palette of Nano-lanterns for real-time multicolor luminescence imaging. Takai A, Nakano M, Saito K, Haruno R, Watanabe TM, Ohyanagi T, Jin T, Okada Y, Nagai T. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):4352-6. doi: 10.1073/pnas.1418468112. Epub 2015 Mar 23. 10.1073/pnas.1418468112 PubMed 25831507