pT2-7xTcf-NLS-ONL-CP
(Plasmid #65716)

• Purpose: Tol2-based Wnt signal reporter plasmid (expresses NLS-ONL-CP)
• Depositing Lab: Yasushi Okada
• Publication: Takai et al Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):4352-6. doi: 10.1073/pnas.1418468112. Epub 2015 Mar 23.

Backbone

• Vector backbone: pBluescript II SK(+) based Tol2 donor vector
• Backbone manufacturer: Agilent Biotechnology, National Institute of Genetics (Dr Koichi Kawakami Lab)
• Backbone size w/o insert (bp): 7700
• Total vector size (bp): 9900
• Vector type: Luciferase
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 7xTcf, minCMV, 3xNLS, ONL, hCL1-PEST
• Alt name: 7xTcf-NLS-ONL-CP
• Species: Synthetic
• Insert Size (bp): 2200

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GGATGGGGCTCTAGGAATAAAATATC
• 3′ sequencing primer: GCTCCAGACTGCCTTGGGAAAAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: hmKusabiraOrange2 (gifted from Dr Atsushi Miyawaki), Tol2 system (gifted from Dr Koichi Kawakami)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry