pcDNA3-MEK5DD-HA
(Plasmid #65247)

• Purpose: Expression of HA tagged dominant active MEK5 in mammalian cells
• Depositing Lab: Axel Ullrich
• Publication: Buschbeck et al J Biol Chem. 2002 Aug 16;277(33):29503-9. Epub 2002 May 31.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5446
• Total vector size (bp): 6796
• Modifications to backbone: in-frame HA tag between ApaI and XhoI sites of pcDNA3
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MEK5DD
• Alt name: MAP2K5DD
• Species: H. sapiens (human)
• Insert Size (bp): 1350
• Mutation: changed Ser311 to Asp, Ser315 to Asp
• GenBank ID: NM_145160
• Entrez Gene: MAP2K5 (a.k.a. HsT17454, MAPKK5, MEK5, PRKMK5)
• Promoter: CMV
• Tag / Fusion Protein:
  • HA (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CACTGCTTACTGGCTTATCG
• 3′ sequencing primer: TGGCAACTAGAAGGCACAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry