Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3-MEK5DD-HA
(Plasmid #65247)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65247 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 6796
  • Modifications to backbone
    in-frame HA tag between ApaI and XhoI sites of pcDNA3
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MEK5DD
  • Alt name
    MAP2K5DD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1350
  • Mutation
    changed Ser311 to Asp, Ser315 to Asp
  • GenBank ID
    NM_145160
  • Entrez Gene
    MAP2K5 (a.k.a. HsT17454, MAPKK5, MEK5, PRKMK5)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CACTGCTTACTGGCTTATCG
  • 3′ sequencing primer TGGCAACTAGAAGGCACAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-MEK5DD-HA was a gift from Axel Ullrich (Addgene plasmid # 65247 ; http://n2t.net/addgene:65247 ; RRID:Addgene_65247)
  • For your References section:

    Phosphotyrosine-specific phosphatase PTP-SL regulates the ERK5 signaling pathway. Buschbeck M, Eickhoff J, Sommer MN, Ullrich A. J Biol Chem. 2002 Aug 16;277(33):29503-9. Epub 2002 May 31. 10.1074/jbc.M202149200 PubMed 12042304