pcDNA3-HA-ERK5kin
(Plasmid
#65245)
-
PurposeExpression of HA tagged ERK5 kinase domain in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5446
- Total vector size (bp) 6646
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameERK5kin
-
Alt nameMAPK7kin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1200
-
Mutationdeleted AA 410-817
-
GenBank IDNM_139033
-
Entrez GeneMAPK7 (a.k.a. BMK1, ERK4, ERK5, PRKM7)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CACTGCTTACTGGCTTATCG
- 3′ sequencing primer TGGCAACTAGAAGGCACAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert codes for kinase domain of ERK5 (AA 2-409)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-HA-ERK5kin was a gift from Axel Ullrich (Addgene plasmid # 65245 ; http://n2t.net/addgene:65245 ; RRID:Addgene_65245) -
For your References section:
Phosphotyrosine-specific phosphatase PTP-SL regulates the ERK5 signaling pathway. Buschbeck M, Eickhoff J, Sommer MN, Ullrich A. J Biol Chem. 2002 Aug 16;277(33):29503-9. Epub 2002 May 31. 10.1074/jbc.M202149200 PubMed 12042304