Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MLM3636-Prnp-CDS-Neg
(Plasmid #61856)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61856 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    MLM3636
  • Backbone manufacturer
    Joung lab MLM3636
  • Backbone size w/o insert (bp) 2278
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PrP guiding sequence
  • Alt name
    PrPC
  • gRNA/shRNA sequence
    TTGGCCCCATCCACCGCCAT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Prnp (a.k.a. CD230, PrP, PrP<C>, PrPC, PrPSc, Prn-i, Prn-p, Sinc, prP27-30, prP33-35C)
  • Promoter hU6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer OS280 (5’-CAGGGTTATTGTCTCATGAGCGG-3’)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The original plasmid was purchased from Addgene: MLM3636.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MLM3636-Prnp-CDS-Neg was a gift from Gerold Schmitt-Ulms (Addgene plasmid # 61856 ; http://n2t.net/addgene:61856 ; RRID:Addgene_61856)
  • For your References section:

    CRISPR-Cas9-Based Knockout of the Prion Protein and Its Effect on the Proteome. Mehrabian M, Brethour D, MacIsaac S, Kim JK, Gunawardana CG, Wang H, Schmitt-Ulms G. PLoS One. 2014 Dec 9;9(12):e114594. doi: 10.1371/journal.pone.0114594. eCollection 2014. PONE-D-14-36316 [pii] PubMed 25490046