Skip to main content
Addgene

mCh-Sec61 beta
(Plasmid #49155)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49155 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAcGFP1-C1
  • Backbone manufacturer
    Clontech
  • Modifications to backbone
    monomeric mCherry was inserted into NheI/BglII sites of pAcGFP1-C1.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Sec61 beta
  • Alt name
    SEC61B
  • Species
    H. sapiens (human)
  • Entrez Gene
    SEC61B
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry* (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer mCherry-F (ccccgtaatgcagaagaaga)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

*Note that the AcGFP1 is still present in this plasmid, but it is not expressed.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCh-Sec61 beta was a gift from Gia Voeltz (Addgene plasmid # 49155 ; http://n2t.net/addgene:49155 ; RRID:Addgene_49155)
  • For your References section:

    Reticulon short hairpin transmembrane domains are used to shape ER tubules. Zurek N, Sparks L, Voeltz G. Traffic. 2011 Jan;12(1):28-41. doi: 10.1111/j.1600-0854.2010.01134.x. Epub 2010 Nov 12. 10.1111/j.1600-0854.2010.01134.x PubMed 20955502