lentiCas9-Blast
(Plasmid #52962)

• Purpose: Expresses human codon-optimized S. pyogenes Cas9 protein and blasticidin resistance from EFS promoter. 3rd generation lentiviral backbone.
• Depositing Lab: Feng Zhang
• Publication: Sanjana et al Nat Methods. 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047.

Backbone

• Vector backbone: pFUGW
• Backbone size w/o insert (bp): 10130
• Total vector size (bp): 12860
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use SapI digest to check for unwanted recombination of lentiviral plasmid. Only amplify in RecA- bacteria (eg. Stbl3).
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Cas9
• Alt name: S. pyogenes CRISPR-Cas9
• Species: Synthetic
• Insert Size (bp): 4200
• Promoter: EFS-NS
• Tag / Fusion Protein:
  • FLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI, XbaI, AfeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: pLLU-F (5'-gggacagcagagatccagtt-3')
• 3′ sequencing primer: blast-R (5'-gctctttcaatgagggtgga-3'​)

Gene/Insert 2

• Gene/Insert name: Blasticidin resistance
• Alt name: blasticidin S deaminase
• Alt name: bsd
• Insert Size (bp): 399
• Promoter: EFS-NS

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: needs custom
• 3′ sequencing primer: WPRE-R

Resource Information

• Supplemental Documents:
  • GenBank file
  • lentiCRISPRv2 and lentiGuide oligo cloning protocol
• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 677 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.

Information for Lentiviral Prep (Catalog # 52962-LV)

Purpose

Ready-to-use Lentiviral Prep particles produced from lentiCas9-Blast (#52962). In addition to the viral particles, you will also receive purified lentiCas9-Blast plasmid DNA.

Lentiviral particles carrying Cas9 and blasticidin resistance. This virus is used to make stable cell lines expressing Cas9.

Delivery

• Volume: 1mL
• Titer: ≥1x10⁵ TU/mL
• Pricing: $150 USD for preparation of 1mL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: OptiPro
• Selectable Marker: Blasticidin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Titering Method:

• Colony formation assay: A549 cells were transduced with serial dilutions of 52962-LV and treated with blasticidin. Blasticidin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet, and counted.

Notes:

• PCR confirmation of insert: PCR was carried out on the viral preparation with primers targeting Cas9 and the blasticidin-resistance gene. The PCR product was visualized on an agarose gel for size confirmation.
  Forward Primer: dCas9-F2 CCAAAGAGGTGCTGGACG
  Reverse Primer: Blast-R GCTCTTTCAATGAGGGTGGA
• Confirmation of protein expression: A549 cells were transduced with serial dilutions of 52962-LV and treated with blasticidin. Polyclonal pools of blasticidin-resistant cells were expanded, collected, lysed and tested for Cas9 expression via immunoblotting. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Visit our viral production page for more information.

Addgene Comments

While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/mL, titers for large or toxic inserts, such as for Cas9, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from Cas9 should expect similarly low titers.

To demonstrate that Addgene’s virus is fully functional, Addgene has generated stable cell lines from the Cas9-expressing lentiviruses. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.