pTG-mTDG-K341R
(Plasmid
#52267)
-
PurposeBacterial expression of mouse TDG-K341R with C-terminal GST-tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52267 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTXB3
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 6707
- Total vector size (bp) 7818
-
Modifications to backboneGyrA-intein-CBD domain replaced by PreScission protease cleavage site-GST unit
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsIn combination with a second vector for protein expression in BL21(DE3) cells, the selection pressure was reduced by half to 50 mg/L Ampicillin
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTDG
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1265
-
MutationK341R, SUMO acceptor site mutation
-
GenBank IDNM_011561.2
-
Entrez GeneTdg (a.k.a. E130317C12Rik, JZA-3, Jza, Jza1)
- Promoter T7
-
Tag
/ Fusion Protein
- GST (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made by
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTG-mTDG-K341R was a gift from Primo Schaer (Addgene plasmid # 52267 ; http://n2t.net/addgene:52267 ; RRID:Addgene_52267) -
For your References section:
Versatile Recombinant SUMOylation System for the Production of SUMO-Modified Protein. Weber AR, Schuermann D, Schar P. PLoS One. 2014 Jul 9;9(7):e102157. doi: 10.1371/journal.pone.0102157. eCollection 2014. 10.1371/journal.pone.0102157 PubMed 25007328