pTG-mTDG-K341R
(Plasmid #52267)

• Purpose: Bacterial expression of mouse TDG-K341R with C-terminal GST-tag
• Depositing Lab: Primo Schaer
• Publication: Weber et al PLoS One. 2014 Jul 9;9(7):e102157. doi: 10.1371/journal.pone.0102157. eCollection 2014.

Backbone

• Vector backbone: pTXB3
• Backbone manufacturer: New England Biolabs
• Backbone size w/o insert (bp): 6707
• Total vector size (bp): 7818
• Modifications to backbone: GyrA-intein-CBD domain replaced by PreScission protease cleavage site-GST unit
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: In combination with a second vector for protein expression in BL21(DE3) cells, the selection pressure was reduced by half to 50 mg/L Ampicillin
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TDG
• Species: M. musculus (mouse)
• Insert Size (bp): 1265
• Mutation: K341R, SUMO acceptor site mutation
• GenBank ID: NM_011561.2
• Entrez Gene: Tdg (a.k.a. E130317C12Rik, JZA-3, Jza, Jza1)
• Promoter: T7
• Tag / Fusion Protein:
  • GST (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by:

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry