p35ST
(Plasmid #51514)

• Purpose: pMDC32 with T30 TALEN pair followed by the us:NPTII donor molecule
• Depositing Lab: Daniel Voytas
• Publication: Baltes et al Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792

Backbone

• Vector backbone: pMDC32
• Backbone size w/o insert (bp): 11752
• Total vector size (bp): 19573
• Vector type: plant expression T-DNA
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: T30 TALEN pair
• Species: Xanthomonas
• Insert Size (bp): 6600
• Promoter: 2x35S
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • flag (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ccgaattcgcccttcaccatgg
• 3′ sequencing primer: attcgccctttccggaagctg

Gene/Insert 2

• Gene/Insert name: us:NPTII repair template
• Insert Size (bp): 2600

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: agcagtcttacttccatgat
• 3′ sequencing primer: tcagaagaactcgtcaagaagg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: T30 TALEN pair was cloned from pZHY528 into pNJB91. us:nptII repair template was amplified by PCR using pDW1269 and cloned into pNJB80. pNJB80 and pNJB91 were used in a multi-site Gateway reaction with pMDC32.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Cellectis Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note that there may be some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. These discrepancies are not in functionally relevant regions of the plasmid. Also, note that Addgene was unable to sequence the RVD region of this plasmid due the repetitive nature of the sequence around it.