Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLSLT
(Plasmid #51498)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51498 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAMBIA1300
  • Backbone size w/o insert (bp) 12921
  • Total vector size (bp) 20743
  • Modifications to backbone
    cis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-LIR orientation.
  • Vector type
    plant T-DNA plasmid
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    T30 TALEN pair
  • Species
    Xanthomonas
  • Insert Size (bp)
    6600
  • Promoter virion-sense LIR and 2x35S

Cloning Information for Gene/Insert 1

  • Cloning method Gateway Cloning
  • 5′ sequencing primer tcattgtctttgttgtgtatt
  • 3′ sequencing primer atcaattcccgatctagtaac
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    us:NPTII repair template
  • Insert Size (bp)
    2600

Cloning Information for Gene/Insert 2

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gtcttacttccatgatttct
  • 3′ sequencing primer tcagaagaactcgtcaagaa
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    T30 TALEN pair was obtained by digesting pZHY528 with restriction enzymes to release the two TALENs. us:NPTII repair template was PCR amplified pDW1269.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that Addgene was unable to sequence the RVD region of this plasmid due the repetitive nature of the sequence around it.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLSLT was a gift from Daniel Voytas (Addgene plasmid # 51498 ; http://n2t.net/addgene:51498 ; RRID:Addgene_51498)
  • For your References section:

    DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519
Commonly requested with: