Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pNJB80
(Plasmid #51518)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51518 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCR8
  • Backbone size (bp) 4000
  • Modifications to backbone
    AttL1 site was replaced with AttL5 site and Chloramphenicol and ccdB genes were cloned in between the Att sites.
  • Vector type
    Gateway entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer gaggatccggcttactaaaag
  • 3′ sequencing primer agtgatttttttctccatttt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    A long oligo containing the attL5 sequence was ordered from Invitrogen. The sequence was fused to the ccdB Chloramphenicol sequence obtained from pFZ19 by PCR amplification.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A single nucleotide from the attL5 sequence is missing (an extra A should be at the 5' end of attL5).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNJB80 was a gift from Daniel Voytas (Addgene plasmid # 51518 ; http://n2t.net/addgene:51518 ; RRID:Addgene_51518)
  • For your References section:

    DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519
Commonly requested with: